Incidental Mutation 'R8281:Drc7'
ID638203
Institutional Source Beutler Lab
Gene Symbol Drc7
Ensembl Gene ENSMUSG00000031786
Gene Namedynein regulatory complex subunit 7
SynonymsSRG-L, LOC330830, Ccdc135
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8281 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location95055103-95078141 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 95062177 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 288 (E288K)
Ref Sequence ENSEMBL: ENSMUSP00000053972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058479]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058479
AA Change: E288K

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000053972
Gene: ENSMUSG00000031786
AA Change: E288K

DomainStartEndE-ValueType
coiled coil region 1 33 N/A INTRINSIC
low complexity region 229 246 N/A INTRINSIC
coiled coil region 258 295 N/A INTRINSIC
low complexity region 388 411 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
low complexity region 695 710 N/A INTRINSIC
low complexity region 798 809 N/A INTRINSIC
low complexity region 848 864 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T A 5: 24,549,010 H417L probably benign Het
Adam7 G A 14: 68,507,885 T630I possibly damaging Het
Adgrf3 T C 5: 30,197,303 S576G possibly damaging Het
Asxl1 A G 2: 153,399,401 R625G probably damaging Het
Atp1a1 A G 3: 101,579,624 F916L probably benign Het
Axl C T 7: 25,763,954 D633N probably benign Het
B230359F08Rik A G 14: 53,795,461 R3G possibly damaging Het
Chd9 A G 8: 91,036,597 D2350G probably damaging Het
Cic G A 7: 25,271,824 V327I probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Crym T A 7: 120,202,027 probably benign Het
Cyp3a13 G C 5: 137,894,297 S495C probably benign Het
D5Ertd579e A T 5: 36,613,320 F137I Het
Dip2a T C 10: 76,276,604 T1087A probably damaging Het
Epb41l4a T C 18: 33,878,945 E174G probably damaging Het
Ern2 T C 7: 122,170,260 R848G probably damaging Het
F13b G T 1: 139,510,951 R364S probably benign Het
F2rl1 A G 13: 95,514,077 L99P probably damaging Het
Fam193a C A 5: 34,443,436 N171K unknown Het
Fst A G 13: 114,455,241 S201P probably benign Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Gm597 C T 1: 28,778,144 C269Y possibly damaging Het
Gm6460 T A 5: 11,597,679 M128K probably damaging Het
Gm8232 A G 14: 44,437,091 I182V Het
Gm8251 T G 1: 44,056,538 D1800A possibly damaging Het
Kalrn C T 16: 34,035,061 W1956* probably null Het
Klk1b16 A G 7: 44,141,547 M258V probably benign Het
Lta4h G T 10: 93,453,594 D29Y probably damaging Het
March7 C T 2: 60,234,529 S383L probably benign Het
Mob3c T C 4: 115,831,438 I56T probably benign Het
Msl2 T C 9: 101,101,695 S423P probably benign Het
Otop3 T C 11: 115,345,075 I511T possibly damaging Het
Pbld2 T G 10: 63,048,026 L90R probably damaging Het
Pcdh8 A G 14: 79,769,479 V548A probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Plch2 T A 4: 155,006,973 M228L probably benign Het
Prkdc T C 16: 15,705,253 C1180R probably damaging Het
Rasl2-9 A T 7: 5,125,352 L193* probably null Het
Rbp3 A G 14: 33,956,363 K756R probably benign Het
Rp1 T C 1: 4,347,916 E991G probably damaging Het
Slc12a7 G A 13: 73,790,677 R191H probably damaging Het
Spaca6 A G 17: 17,832,059 N87S possibly damaging Het
Stab2 A T 10: 86,873,864 V1639E probably damaging Het
Thpo T C 16: 20,725,775 N235S possibly damaging Het
Tmem63b T A 17: 45,660,796 H831L probably benign Het
Tomm20l T C 12: 71,111,467 V8A probably benign Het
Vill T C 9: 119,058,479 S104P probably damaging Het
Other mutations in Drc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Drc7 APN 8 95056001 splice site probably benign
IGL00922:Drc7 APN 8 95077978 missense probably benign 0.00
IGL01610:Drc7 APN 8 95077802 missense probably damaging 1.00
IGL01642:Drc7 APN 8 95059139 missense probably benign 0.34
IGL01793:Drc7 APN 8 95071277 missense probably benign 0.25
IGL01936:Drc7 APN 8 95074132 missense possibly damaging 0.89
IGL01953:Drc7 APN 8 95059125 missense probably damaging 1.00
IGL01998:Drc7 APN 8 95059193 missense probably damaging 1.00
IGL02237:Drc7 APN 8 95072879 missense probably damaging 1.00
IGL02259:Drc7 APN 8 95056105 missense probably benign
IGL02285:Drc7 APN 8 95071233 splice site probably benign
IGL02940:Drc7 APN 8 95074297 missense probably damaging 0.99
IGL03032:Drc7 APN 8 95076247 splice site probably benign
IGL03181:Drc7 APN 8 95068127 missense probably benign 0.00
R0018:Drc7 UTSW 8 95074234 missense probably damaging 0.99
R0018:Drc7 UTSW 8 95074234 missense probably damaging 0.99
R0281:Drc7 UTSW 8 95071253 missense possibly damaging 0.61
R0304:Drc7 UTSW 8 95059128 missense probably damaging 1.00
R0362:Drc7 UTSW 8 95072855 missense probably benign 0.00
R1127:Drc7 UTSW 8 95072788 missense probably damaging 0.98
R1635:Drc7 UTSW 8 95074332 critical splice donor site probably null
R1921:Drc7 UTSW 8 95056016 missense unknown
R1931:Drc7 UTSW 8 95071253 missense possibly damaging 0.61
R2256:Drc7 UTSW 8 95075009 missense probably benign 0.16
R3851:Drc7 UTSW 8 95061836 nonsense probably null
R4797:Drc7 UTSW 8 95074297 missense probably damaging 0.96
R4827:Drc7 UTSW 8 95071639 missense probably damaging 0.98
R4966:Drc7 UTSW 8 95071596 missense probably benign 0.45
R5194:Drc7 UTSW 8 95061717 missense probably benign 0.00
R5721:Drc7 UTSW 8 95074333 critical splice donor site probably null
R5911:Drc7 UTSW 8 95074126 missense probably damaging 1.00
R5993:Drc7 UTSW 8 95074192 missense probably benign
R6056:Drc7 UTSW 8 95075051 missense probably damaging 1.00
R6534:Drc7 UTSW 8 95071282 missense probably damaging 1.00
R6576:Drc7 UTSW 8 95075258 missense probably damaging 0.98
R6861:Drc7 UTSW 8 95062397 critical splice donor site probably null
R7104:Drc7 UTSW 8 95059083 missense probably damaging 0.99
R7157:Drc7 UTSW 8 95074150 missense probably damaging 0.99
R7205:Drc7 UTSW 8 95077921 missense probably damaging 1.00
R7283:Drc7 UTSW 8 95071579 missense probably damaging 0.99
R7351:Drc7 UTSW 8 95058507 missense probably benign 0.25
R7567:Drc7 UTSW 8 95068056 missense probably benign 0.00
R8211:Drc7 UTSW 8 95056079 missense unknown
R8401:Drc7 UTSW 8 95074135 missense probably benign
Y5404:Drc7 UTSW 8 95068150 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GCCTTTCTTTGGATGAAATCTCAC -3'
(R):5'- CAGCAGTTCCAGCAATCCTG -3'

Sequencing Primer
(F):5'- CTTTGGATGAAATCTCACCTAGGG -3'
(R):5'- CAATCCTGCATGTTGATCCAGTAG -3'
Posted On2020-07-28