Incidental Mutation 'R8259:Cyp2a12'
ID 640431
Institutional Source Beutler Lab
Gene Symbol Cyp2a12
Ensembl Gene ENSMUSG00000060407
Gene Name cytochrome P450, family 2, subfamily a, polypeptide 12
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock # R8259 (G1)
Quality Score 184.009
Status Validated
Chromosome 7
Chromosomal Location 27029081-27037375 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 27032658 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 275 (Q275*)
Ref Sequence ENSEMBL: ENSMUSP00000074990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075552]
AlphaFold P56593
Predicted Effect probably null
Transcript: ENSMUST00000075552
AA Change: Q275*
SMART Domains Protein: ENSMUSP00000074990
Gene: ENSMUSG00000060407
AA Change: Q275*

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:p450 33 489 7.3e-153 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (82/82)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,682,481 E1206G probably benign Het
Abca15 A T 7: 120,340,199 H272L probably benign Het
Abcg5 T G 17: 84,676,095 T144P possibly damaging Het
Adam34 G A 8: 43,651,609 S333L probably benign Het
Adcy6 A G 15: 98,601,038 F294S probably damaging Het
Adhfe1 A G 1: 9,558,192 N263S probably null Het
Aebp2 A T 6: 140,637,727 Q309L possibly damaging Het
Akap7 A G 10: 25,171,156 Y281H probably damaging Het
Aplf T C 6: 87,630,005 R476G probably benign Het
Atg2a G A 19: 6,249,829 A588T probably damaging Het
Birc6 A G 17: 74,598,078 T1289A probably benign Het
Cacna1d A G 14: 30,051,518 S1759P probably benign Het
Calcoco1 T C 15: 102,715,793 D236G probably damaging Het
Camsap2 A T 1: 136,280,339 D470E probably benign Het
Capn8 G T 1: 182,565,133 V25L probably benign Het
Card10 A G 15: 78,776,684 V1041A probably damaging Het
Ccr1 T A 9: 123,964,082 H137L probably damaging Het
Cdh23 A T 10: 60,315,656 D2483E probably damaging Het
Chd2 G T 7: 73,435,784 Q1701K probably benign Het
Ckmt2 T A 13: 91,859,216 R286S probably damaging Het
Clhc1 G A 11: 29,553,746 R54Q probably benign Het
Cntnap3 T A 13: 64,787,867 D394V probably damaging Het
Comp A G 8: 70,379,054 D441G probably damaging Het
Cyp20a1 G A 1: 60,352,171 probably null Het
Cyp27a1 A T 1: 74,732,055 D133V probably benign Het
Dnhd1 A T 7: 105,694,788 I1780L probably benign Het
Dpy19l2 A G 9: 24,669,406 V213A probably benign Het
Eml1 A T 12: 108,510,199 I283F probably damaging Het
Ep300 A G 15: 81,639,017 T1281A unknown Het
Ercc6l2 G A 13: 63,872,471 E803K Het
Fat3 A G 9: 15,990,591 V3046A possibly damaging Het
Fbxw20 A G 9: 109,234,695 V3A probably benign Het
Fcgr2b A G 1: 170,968,133 S76P possibly damaging Het
Fgg C T 3: 83,010,170 Q169* probably null Het
Flnb A G 14: 7,889,183 Y511C probably damaging Het
Ggt5 G A 10: 75,614,832 V558I probably benign Het
Gm4779 G C X: 101,793,784 T171S possibly damaging Het
Greb1 A T 12: 16,724,924 C157* probably null Het
Grid2ip A G 5: 143,362,589 E145G probably benign Het
Hdac11 T A 6: 91,172,228 V238E probably damaging Het
Herc2 A G 7: 56,205,890 D3858G probably damaging Het
Hoxc4 A G 15: 103,034,739 Y6C probably damaging Het
Incenp A G 19: 9,893,629 L212P unknown Het
Incenp G C 19: 9,893,641 T208R unknown Het
Mctp1 T A 13: 76,801,547 probably null Het
Megf8 T C 7: 25,358,423 M2095T probably benign Het
Mroh2b G A 15: 4,911,909 V308I probably benign Het
Muc1 T A 3: 89,232,034 H580Q probably damaging Het
Naip6 A T 13: 100,316,412 M47K probably benign Het
Nectin3 C T 16: 46,436,391 R419Q probably benign Het
Nlrp4g T G 9: 124,353,392 Y579D noncoding transcript Het
Nrxn1 C A 17: 90,163,821 R1260L probably damaging Het
Nynrin A G 14: 55,863,358 I202V possibly damaging Het
Olfr128 T C 17: 37,923,956 L130P probably damaging Het
Olfr1450 T C 19: 12,954,363 M258T possibly damaging Het
Olfr199 T C 16: 59,216,095 I173V probably benign Het
Olfr78 A G 7: 102,742,827 Y59H probably damaging Het
Pard3 G A 8: 127,371,540 W354* probably null Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Peak1 A G 9: 56,259,393 V417A probably damaging Het
Prune2 A G 19: 17,212,308 R3052G unknown Het
Prx T C 7: 27,519,383 L1242P probably damaging Het
Pxylp1 A G 9: 96,825,580 I183T probably benign Het
Ranbp2 A G 10: 58,455,933 E254G probably benign Het
Ren1 C T 1: 133,350,796 R31* probably null Het
Rhot2 C A 17: 25,839,890 R512L probably benign Het
Rpa1 T C 11: 75,302,724 N594D probably benign Het
Rpp14 T G 14: 8,090,526 V150G probably null Het
Rxfp2 T A 5: 150,059,900 I300K probably damaging Het
Sbno1 A T 5: 124,381,696 V1173E probably damaging Het
Scarf1 T A 11: 75,523,863 S486T probably damaging Het
Slc24a4 T C 12: 102,254,669 V455A probably damaging Het
Slitrk1 A G 14: 108,911,221 V686A probably benign Het
Ston2 A T 12: 91,641,680 I882N probably benign Het
Syne2 C A 12: 75,949,369 Q2228K possibly damaging Het
Tcf20 A C 15: 82,852,273 F1659C probably damaging Het
Tenm4 G A 7: 96,867,991 G1430S probably damaging Het
Tlr12 C A 4: 128,617,699 A253S probably benign Het
Tmem87a A G 2: 120,397,447 F73S possibly damaging Het
Trpm1 G A 7: 64,269,029 A1590T probably benign Het
Usp13 C T 3: 32,917,599 Q743* probably null Het
Vmn1r184 T A 7: 26,267,261 M144K probably benign Het
Wee2 A G 6: 40,444,180 D68G probably benign Het
Other mutations in Cyp2a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02191:Cyp2a12 APN 7 27036611 missense probably benign 0.00
IGL02306:Cyp2a12 APN 7 27032583 missense probably damaging 1.00
IGL02667:Cyp2a12 APN 7 27031158 missense probably damaging 1.00
IGL02943:Cyp2a12 APN 7 27032542 missense probably benign 0.07
IGL03025:Cyp2a12 APN 7 27031206 missense probably benign 0.00
IGL03230:Cyp2a12 APN 7 27029592 missense possibly damaging 0.48
PIT4243001:Cyp2a12 UTSW 7 27034773 missense probably benign 0.00
PIT4618001:Cyp2a12 UTSW 7 27034773 missense probably benign 0.00
R0655:Cyp2a12 UTSW 7 27036621 missense probably benign 0.15
R0659:Cyp2a12 UTSW 7 27034138 missense probably damaging 1.00
R0743:Cyp2a12 UTSW 7 27032542 missense probably benign 0.07
R0884:Cyp2a12 UTSW 7 27032542 missense probably benign 0.07
R2118:Cyp2a12 UTSW 7 27036646 makesense probably null
R2119:Cyp2a12 UTSW 7 27036646 makesense probably null
R2120:Cyp2a12 UTSW 7 27036646 makesense probably null
R2121:Cyp2a12 UTSW 7 27036646 makesense probably null
R2122:Cyp2a12 UTSW 7 27036646 makesense probably null
R2124:Cyp2a12 UTSW 7 27036646 makesense probably null
R2144:Cyp2a12 UTSW 7 27034769 missense possibly damaging 0.95
R2153:Cyp2a12 UTSW 7 27032617 missense probably benign 0.01
R2171:Cyp2a12 UTSW 7 27029632 missense probably damaging 1.00
R2182:Cyp2a12 UTSW 7 27031146 missense probably damaging 1.00
R2297:Cyp2a12 UTSW 7 27034632 missense possibly damaging 0.92
R4392:Cyp2a12 UTSW 7 27029275 missense probably damaging 0.98
R4900:Cyp2a12 UTSW 7 27031215 nonsense probably null
R4960:Cyp2a12 UTSW 7 27034150 missense probably benign 0.11
R5111:Cyp2a12 UTSW 7 27036621 missense possibly damaging 0.89
R5143:Cyp2a12 UTSW 7 27036611 missense probably benign 0.00
R5223:Cyp2a12 UTSW 7 27036463 critical splice acceptor site probably null
R5268:Cyp2a12 UTSW 7 27031218 missense probably benign 0.00
R5493:Cyp2a12 UTSW 7 27029125 missense unknown
R5524:Cyp2a12 UTSW 7 27031231 missense probably benign 0.00
R5806:Cyp2a12 UTSW 7 27029079 splice site probably null
R6320:Cyp2a12 UTSW 7 27031152 missense possibly damaging 0.75
R6823:Cyp2a12 UTSW 7 27034156 missense possibly damaging 0.77
R7958:Cyp2a12 UTSW 7 27029252 missense probably benign 0.13
R8093:Cyp2a12 UTSW 7 27036629 missense probably damaging 0.96
R8191:Cyp2a12 UTSW 7 27031104 missense probably benign 0.00
R9083:Cyp2a12 UTSW 7 27036519 missense probably damaging 0.99
R9084:Cyp2a12 UTSW 7 27036519 missense probably damaging 0.99
R9085:Cyp2a12 UTSW 7 27036519 missense probably damaging 0.99
R9086:Cyp2a12 UTSW 7 27036519 missense probably damaging 0.99
RF021:Cyp2a12 UTSW 7 27035360 missense possibly damaging 0.73
Z1088:Cyp2a12 UTSW 7 27035420 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TGGGTGTTGCTACTGACAC -3'
(R):5'- CCATACCCTGGCTTGCATAAG -3'

Sequencing Primer
(F):5'- GGTGTTGCTACTGACACGTCTC -3'
(R):5'- TACCCTGGCTTGCATAAGGAAGG -3'
Posted On 2020-07-28