Incidental Mutation 'R8343:Kcnh7'
ID644993
Institutional Source Beutler Lab
Gene Symbol Kcnh7
Ensembl Gene ENSMUSG00000059742
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 7
SynonymsKv11.3, 9330137I11Rik, erg3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R8343 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location62693414-63184287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62850535 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 236 (D236G)
Ref Sequence ENSEMBL: ENSMUSP00000074563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075052] [ENSMUST00000112452] [ENSMUST00000112454]
Predicted Effect probably benign
Transcript: ENSMUST00000075052
AA Change: D236G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000074563
Gene: ENSMUSG00000059742
AA Change: D236G

DomainStartEndE-ValueType
PAS 20 87 8.97e0 SMART
PAC 93 135 3.48e-1 SMART
Pfam:Ion_trans 407 674 4.9e-39 PFAM
Pfam:Ion_trans_2 588 668 3.2e-13 PFAM
cNMP 745 863 1.5e-23 SMART
low complexity region 921 940 N/A INTRINSIC
coiled coil region 1022 1058 N/A INTRINSIC
low complexity region 1114 1127 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112452
AA Change: D236G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000108071
Gene: ENSMUSG00000059742
AA Change: D236G

DomainStartEndE-ValueType
PAS 20 87 8.97e0 SMART
PAC 93 135 3.48e-1 SMART
Blast:MYSc 309 426 4e-24 BLAST
low complexity region 446 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112454
AA Change: D236G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108073
Gene: ENSMUSG00000059742
AA Change: D236G

DomainStartEndE-ValueType
PAS 20 87 8.97e0 SMART
PAC 93 135 3.48e-1 SMART
Blast:MYSc 316 433 3e-24 BLAST
low complexity region 453 468 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. There are at least two alternatively spliced transcript variants derived from this gene and encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,040,729 W156R probably damaging Het
Acvr1 T A 2: 58,474,274 probably null Het
Adamts2 G T 11: 50,603,488 V130L probably damaging Het
Adcy4 C T 14: 55,775,240 V541I probably benign Het
Adgrl2 C T 3: 148,846,906 V654I probably damaging Het
Ago3 T A 4: 126,376,928 K258* probably null Het
Akap11 A T 14: 78,512,489 S819R Het
Alox5ap T C 5: 149,287,609 F121L probably damaging Het
Baz2b A T 2: 59,901,514 M2060K probably damaging Het
C030005K15Rik T C 10: 97,725,552 I106V unknown Het
Carmil2 T A 8: 105,691,084 S604T probably benign Het
Cdhr1 T C 14: 37,091,978 T164A probably benign Het
Dhx30 T C 9: 110,085,501 E976G possibly damaging Het
Dnah17 C T 11: 118,114,195 G788R probably benign Het
Dus2 T C 8: 105,996,013 probably benign Het
Etv6 T C 6: 134,248,754 V316A possibly damaging Het
Fabp9 T G 3: 10,194,025 K107T possibly damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Gapdh A G 6: 125,163,263 V92A probably benign Het
Gfy A G 7: 45,176,595 L453P probably damaging Het
Gm6588 C T 5: 112,450,787 T400I probably benign Het
Gp2 C T 7: 119,442,787 C505Y probably benign Het
Gtpbp8 T C 16: 44,746,313 R9G probably benign Het
Hipk4 G T 7: 27,523,608 R31L probably damaging Het
Htt T A 5: 34,905,724 M2900K probably damaging Het
Ighv1-20 T C 12: 114,724,190 I6V probably benign Het
Il17d C T 14: 57,542,480 T153I probably damaging Het
Izumo3 T A 4: 92,146,344 N117I probably damaging Het
Kmt2d T C 15: 98,852,597 D2405G unknown Het
Map4k2 T C 19: 6,346,566 W533R probably damaging Het
Matn1 C A 4: 130,945,989 Y89* probably null Het
Mettl18 T A 1: 163,996,940 Y277N probably damaging Het
Muc5b G A 7: 141,864,161 G3615S probably benign Het
Mycbp2 A C 14: 103,160,675 probably null Het
Myh4 T A 11: 67,252,564 S1041T possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naaladl1 T C 19: 6,109,673 V378A possibly damaging Het
Nars T C 18: 64,504,387 D374G probably benign Het
Neb C T 2: 52,308,271 probably null Het
Neurl1b A G 17: 26,431,991 Y79C probably damaging Het
Nynrin A G 14: 55,863,791 T306A probably benign Het
Ola1 G T 2: 73,199,401 R125S probably damaging Het
Olfr105-ps T A 17: 37,383,231 F221L probably benign Het
Olfr644 A T 7: 104,068,176 V285D probably damaging Het
Pak1ip1 C A 13: 41,004,738 T29K probably benign Het
Podnl1 T A 8: 84,130,773 L337H Het
Rictor T G 15: 6,778,319 probably null Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sel1l2 T C 2: 140,230,833 I627M probably benign Het
Sh3rf2 T C 18: 42,111,428 S352P probably damaging Het
Slc6a6 G A 6: 91,726,243 W199* probably null Het
Smc2 T A 4: 52,450,965 V261E probably benign Het
Sorcs3 G A 19: 48,704,369 probably null Het
Spdye4a T A 5: 143,225,807 M1L probably benign Het
Stag1 T C 9: 100,757,766 I125T possibly damaging Het
Stx8 T A 11: 68,020,988 D177E probably benign Het
Sun2 T C 15: 79,738,924 Y71C probably damaging Het
Tmed9 T C 13: 55,594,804 F129L probably benign Het
Tmem216 T A 19: 10,551,972 T17S probably benign Het
Tmpo A T 10: 91,162,112 N604K probably benign Het
Tmprss11f T A 5: 86,533,807 I196F probably benign Het
Tnks A G 8: 34,834,584 F1244L probably benign Het
Tspan2 T C 3: 102,768,910 C212R probably damaging Het
Tspan4 A G 7: 141,491,805 D155G probably damaging Het
Ttc6 T C 12: 57,660,496 F730L possibly damaging Het
Txnrd2 G A 16: 18,426,541 A33T unknown Het
Uhrf1bp1l T C 10: 89,791,419 S449P probably benign Het
Wnk1 C T 6: 119,963,493 R761H probably damaging Het
Zfp217 T C 2: 170,120,104 D101G probably damaging Het
Zfp281 T C 1: 136,627,882 F866S probably damaging Het
Other mutations in Kcnh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Kcnh7 APN 2 62764691 missense probably benign 0.01
IGL00693:Kcnh7 APN 2 62734254 missense probably benign 0.06
IGL00776:Kcnh7 APN 2 62850376 missense probably benign 0.00
IGL00956:Kcnh7 APN 2 62777639 missense probably damaging 1.00
IGL01651:Kcnh7 APN 2 62734284 missense possibly damaging 0.47
IGL01780:Kcnh7 APN 2 62837163 missense probably benign 0.17
IGL01859:Kcnh7 APN 2 62721788 missense probably benign 0.00
IGL02213:Kcnh7 APN 2 62739362 missense probably damaging 1.00
IGL02302:Kcnh7 APN 2 62706058 missense probably damaging 1.00
IGL02526:Kcnh7 APN 2 62850437 missense possibly damaging 0.46
IGL02850:Kcnh7 APN 2 62787685 nonsense probably null
IGL02989:Kcnh7 APN 2 62721925 missense probably benign
IGL02990:Kcnh7 APN 2 62705986 missense probably benign 0.11
G1citation:Kcnh7 UTSW 2 62787904 missense probably damaging 1.00
LCD18:Kcnh7 UTSW 2 63049799 intron probably benign
R0129:Kcnh7 UTSW 2 62716159 missense probably benign 0.00
R0622:Kcnh7 UTSW 2 62837289 splice site probably null
R0638:Kcnh7 UTSW 2 62777510 missense probably benign 0.13
R1006:Kcnh7 UTSW 2 62716183 missense probably benign 0.00
R1200:Kcnh7 UTSW 2 62777395 missense probably damaging 1.00
R1330:Kcnh7 UTSW 2 62777411 missense possibly damaging 0.56
R1614:Kcnh7 UTSW 2 62850604 missense probably benign 0.03
R1782:Kcnh7 UTSW 2 62736169 missense probably damaging 1.00
R1861:Kcnh7 UTSW 2 62777392 missense probably damaging 0.97
R1862:Kcnh7 UTSW 2 62787754 missense possibly damaging 0.46
R2197:Kcnh7 UTSW 2 62777606 missense probably damaging 1.00
R2510:Kcnh7 UTSW 2 62721917 missense probably benign
R2988:Kcnh7 UTSW 2 62721828 missense probably benign 0.20
R3024:Kcnh7 UTSW 2 62764663 missense probably damaging 1.00
R3433:Kcnh7 UTSW 2 62721917 missense probably benign
R4415:Kcnh7 UTSW 2 62706073 missense probably damaging 1.00
R4540:Kcnh7 UTSW 2 62739186 missense probably damaging 1.00
R4570:Kcnh7 UTSW 2 62837095 missense possibly damaging 0.91
R4827:Kcnh7 UTSW 2 62716220 missense probably benign
R4990:Kcnh7 UTSW 2 62734288 missense probably benign 0.00
R5172:Kcnh7 UTSW 2 62739164 missense possibly damaging 0.88
R5822:Kcnh7 UTSW 2 62716238 missense probably benign
R5996:Kcnh7 UTSW 2 63184097 start gained probably benign
R6142:Kcnh7 UTSW 2 62739360 missense possibly damaging 0.95
R6226:Kcnh7 UTSW 2 62777559 missense probably damaging 1.00
R6244:Kcnh7 UTSW 2 63182226 missense probably damaging 1.00
R6304:Kcnh7 UTSW 2 62764616 nonsense probably null
R6400:Kcnh7 UTSW 2 62739344 missense probably damaging 1.00
R6430:Kcnh7 UTSW 2 62850532 missense probably benign 0.04
R6483:Kcnh7 UTSW 2 62845774 missense probably benign 0.06
R6614:Kcnh7 UTSW 2 62777596 missense probably damaging 1.00
R6753:Kcnh7 UTSW 2 62850377 missense probably benign
R6822:Kcnh7 UTSW 2 62787904 missense probably damaging 1.00
R6863:Kcnh7 UTSW 2 62787685 missense possibly damaging 0.83
R7104:Kcnh7 UTSW 2 62787687 missense possibly damaging 0.82
R7116:Kcnh7 UTSW 2 62877270 missense probably benign 0.02
R7263:Kcnh7 UTSW 2 62735970 splice site probably null
R7657:Kcnh7 UTSW 2 62736035 missense probably damaging 1.00
R7855:Kcnh7 UTSW 2 62837194 nonsense probably null
R7968:Kcnh7 UTSW 2 62736100 missense probably damaging 1.00
R8183:Kcnh7 UTSW 2 62702977 missense probably damaging 0.99
R8405:Kcnh7 UTSW 2 62703102 missense probably benign 0.04
R8411:Kcnh7 UTSW 2 62764608 missense probably damaging 1.00
R8493:Kcnh7 UTSW 2 62850659 missense probably benign 0.31
R8744:Kcnh7 UTSW 2 63182089 missense possibly damaging 0.93
X0011:Kcnh7 UTSW 2 62764723 missense probably damaging 0.99
Z1088:Kcnh7 UTSW 2 62736103 missense probably damaging 1.00
Z1088:Kcnh7 UTSW 2 63184068 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCTTCACTGGCATGTCGATC -3'
(R):5'- CTGGACTGAGAGTTCTAACATACAG -3'

Sequencing Primer
(F):5'- CACTGGCATGTCGATCTCTAAATATG -3'
(R):5'- GTCCTTGCCACAGGAAGAC -3'
Posted On2020-09-02