Incidental Mutation 'R5172:Kcnh7'
ID398783
Institutional Source Beutler Lab
Gene Symbol Kcnh7
Ensembl Gene ENSMUSG00000059742
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 7
SynonymsKv11.3, 9330137I11Rik, erg3
MMRRC Submission 042752-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R5172 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location62693414-63184287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62739164 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 796 (D796G)
Ref Sequence ENSEMBL: ENSMUSP00000074563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075052]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075052
AA Change: D796G

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074563
Gene: ENSMUSG00000059742
AA Change: D796G

DomainStartEndE-ValueType
PAS 20 87 8.97e0 SMART
PAC 93 135 3.48e-1 SMART
Pfam:Ion_trans 407 674 4.9e-39 PFAM
Pfam:Ion_trans_2 588 668 3.2e-13 PFAM
cNMP 745 863 1.5e-23 SMART
low complexity region 921 940 N/A INTRINSIC
coiled coil region 1022 1058 N/A INTRINSIC
low complexity region 1114 1127 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. There are at least two alternatively spliced transcript variants derived from this gene and encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 T C 11: 94,375,608 Y52C probably damaging Het
Acmsd C T 1: 127,753,848 R183* probably null Het
Anxa2 T A 9: 69,485,251 D127E probably damaging Het
Atrnl1 T A 19: 57,685,513 Y593* probably null Het
Atxn2 C T 5: 121,795,035 probably null Het
Ccl6 A T 11: 83,589,343 Y66N probably damaging Het
Ccng1 A G 11: 40,751,286 V223A probably benign Het
Cfap44 T C 16: 44,449,193 Y1187H probably benign Het
Cfc1 A T 1: 34,535,930 I10F probably benign Het
Chrne T A 11: 70,615,526 T365S probably benign Het
Clec4b1 G T 6: 123,071,455 R183L probably benign Het
Csmd2 A C 4: 128,477,397 Q1926P probably benign Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dzip1 T A 14: 118,887,151 Q570L probably damaging Het
Fam149a T A 8: 45,344,653 Q507L probably damaging Het
Frem3 T C 8: 80,612,566 V496A probably benign Het
Fryl A T 5: 73,101,673 D589E possibly damaging Het
Hemk1 T C 9: 107,329,432 E4G possibly damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Lemd2 G T 17: 27,195,382 S326* probably null Het
Mdc1 T C 17: 35,853,090 S1177P probably benign Het
Mfsd4b4 A G 10: 39,894,087 F78S probably damaging Het
Mmgt2 T A 11: 62,665,128 F101I possibly damaging Het
Myo18a T C 11: 77,824,098 L785P probably damaging Het
Nup155 C A 15: 8,109,542 Q33K probably benign Het
Olfr1152 A G 2: 87,868,827 T279A probably benign Het
Olfr584 T C 7: 103,085,677 L48P probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pank1 A T 19: 34,840,802 C112* probably null Het
Pcmtd1 T A 1: 7,163,261 M23K probably benign Het
Rere A T 4: 150,570,269 R419S unknown Het
Rpf1 T C 3: 146,512,295 R155G possibly damaging Het
Sema7a A G 9: 57,957,678 T421A probably benign Het
Sharpin A G 15: 76,347,541 S323P probably benign Het
Slamf6 A G 1: 171,936,580 E180G probably benign Het
Snd1 T G 6: 28,886,616 V874G possibly damaging Het
Sult6b2 A T 6: 142,797,931 V123D probably damaging Het
Tpk1 A T 6: 43,560,017 probably null Het
Vmn1r160 A T 7: 22,871,336 N38I probably damaging Het
Wdr93 T A 7: 79,752,493 I180N probably damaging Het
Ythdf3 C T 3: 16,204,034 T119I probably damaging Het
Zc3h18 T G 8: 122,407,420 probably benign Het
Other mutations in Kcnh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Kcnh7 APN 2 62764691 missense probably benign 0.01
IGL00693:Kcnh7 APN 2 62734254 missense probably benign 0.06
IGL00776:Kcnh7 APN 2 62850376 missense probably benign 0.00
IGL00956:Kcnh7 APN 2 62777639 missense probably damaging 1.00
IGL01651:Kcnh7 APN 2 62734284 missense possibly damaging 0.47
IGL01780:Kcnh7 APN 2 62837163 missense probably benign 0.17
IGL01859:Kcnh7 APN 2 62721788 missense probably benign 0.00
IGL02213:Kcnh7 APN 2 62739362 missense probably damaging 1.00
IGL02302:Kcnh7 APN 2 62706058 missense probably damaging 1.00
IGL02526:Kcnh7 APN 2 62850437 missense possibly damaging 0.46
IGL02850:Kcnh7 APN 2 62787685 nonsense probably null
IGL02989:Kcnh7 APN 2 62721925 missense probably benign
IGL02990:Kcnh7 APN 2 62705986 missense probably benign 0.11
G1citation:Kcnh7 UTSW 2 62787904 missense probably damaging 1.00
LCD18:Kcnh7 UTSW 2 63049799 intron probably benign
R0129:Kcnh7 UTSW 2 62716159 missense probably benign 0.00
R0622:Kcnh7 UTSW 2 62837289 splice site probably null
R0638:Kcnh7 UTSW 2 62777510 missense probably benign 0.13
R1006:Kcnh7 UTSW 2 62716183 missense probably benign 0.00
R1200:Kcnh7 UTSW 2 62777395 missense probably damaging 1.00
R1330:Kcnh7 UTSW 2 62777411 missense possibly damaging 0.56
R1614:Kcnh7 UTSW 2 62850604 missense probably benign 0.03
R1782:Kcnh7 UTSW 2 62736169 missense probably damaging 1.00
R1861:Kcnh7 UTSW 2 62777392 missense probably damaging 0.97
R1862:Kcnh7 UTSW 2 62787754 missense possibly damaging 0.46
R2197:Kcnh7 UTSW 2 62777606 missense probably damaging 1.00
R2510:Kcnh7 UTSW 2 62721917 missense probably benign
R2988:Kcnh7 UTSW 2 62721828 missense probably benign 0.20
R3024:Kcnh7 UTSW 2 62764663 missense probably damaging 1.00
R3433:Kcnh7 UTSW 2 62721917 missense probably benign
R4415:Kcnh7 UTSW 2 62706073 missense probably damaging 1.00
R4540:Kcnh7 UTSW 2 62739186 missense probably damaging 1.00
R4570:Kcnh7 UTSW 2 62837095 missense possibly damaging 0.91
R4827:Kcnh7 UTSW 2 62716220 missense probably benign
R4990:Kcnh7 UTSW 2 62734288 missense probably benign 0.00
R5822:Kcnh7 UTSW 2 62716238 missense probably benign
R5996:Kcnh7 UTSW 2 63184097 start gained probably benign
R6142:Kcnh7 UTSW 2 62739360 missense possibly damaging 0.95
R6226:Kcnh7 UTSW 2 62777559 missense probably damaging 1.00
R6244:Kcnh7 UTSW 2 63182226 missense probably damaging 1.00
R6304:Kcnh7 UTSW 2 62764616 nonsense probably null
R6400:Kcnh7 UTSW 2 62739344 missense probably damaging 1.00
R6430:Kcnh7 UTSW 2 62850532 missense probably benign 0.04
R6483:Kcnh7 UTSW 2 62845774 missense probably benign 0.06
R6614:Kcnh7 UTSW 2 62777596 missense probably damaging 1.00
R6753:Kcnh7 UTSW 2 62850377 missense probably benign
R6822:Kcnh7 UTSW 2 62787904 missense probably damaging 1.00
R6863:Kcnh7 UTSW 2 62787685 missense possibly damaging 0.83
R7104:Kcnh7 UTSW 2 62787687 missense possibly damaging 0.82
R7116:Kcnh7 UTSW 2 62877270 missense probably benign 0.02
R7263:Kcnh7 UTSW 2 62735970 splice site probably null
R7657:Kcnh7 UTSW 2 62736035 missense probably damaging 1.00
R7855:Kcnh7 UTSW 2 62837194 nonsense probably null
R7968:Kcnh7 UTSW 2 62736100 missense probably damaging 1.00
R8183:Kcnh7 UTSW 2 62702977 missense probably damaging 0.99
R8343:Kcnh7 UTSW 2 62850535 missense probably benign 0.01
R8405:Kcnh7 UTSW 2 62703102 missense probably benign 0.04
R8411:Kcnh7 UTSW 2 62764608 missense probably damaging 1.00
R8493:Kcnh7 UTSW 2 62850659 missense probably benign 0.31
R8744:Kcnh7 UTSW 2 63182089 missense possibly damaging 0.93
X0011:Kcnh7 UTSW 2 62764723 missense probably damaging 0.99
Z1088:Kcnh7 UTSW 2 62736103 missense probably damaging 1.00
Z1088:Kcnh7 UTSW 2 63184068 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATGAAGCTGAGATCATGC -3'
(R):5'- TACAAAACTGCAAAGCCTTTCG -3'

Sequencing Primer
(F):5'- GACCTCAAATGTCTAAATAGCTGTC -3'
(R):5'- CTGCAAAGCCTTTCGAGGAG -3'
Posted On2016-07-06