Incidental Mutation 'R7368:Sh2b1'
ID571927
Institutional Source Beutler Lab
Gene Symbol Sh2b1
Ensembl Gene ENSMUSG00000030733
Gene NameSH2B adaptor protein 1
SynonymsIrip, SH2-Bb, SH2-B, Sh2bpsm1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.435) question?
Stock #R7368 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location126466994-126475424 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126468513 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 618 (D618E)
Ref Sequence ENSEMBL: ENSMUSP00000145754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032978] [ENSMUST00000205340] [ENSMUST00000205440] [ENSMUST00000205497] [ENSMUST00000205733] [ENSMUST00000205889] [ENSMUST00000206643] [ENSMUST00000206664]
Predicted Effect probably benign
Transcript: ENSMUST00000032978
AA Change: D618E

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000032978
Gene: ENSMUSG00000030733
AA Change: D618E

DomainStartEndE-ValueType
Pfam:Phe_ZIP 25 81 4.6e-25 PFAM
low complexity region 83 99 N/A INTRINSIC
low complexity region 133 151 N/A INTRINSIC
low complexity region 156 168 N/A INTRINSIC
low complexity region 195 205 N/A INTRINSIC
PH 247 378 4.82e-7 SMART
low complexity region 447 460 N/A INTRINSIC
low complexity region 466 483 N/A INTRINSIC
SH2 525 610 2.84e-23 SMART
low complexity region 668 677 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205340
AA Change: D618E

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000205440
AA Change: D618E

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect possibly damaging
Transcript: ENSMUST00000205497
AA Change: D618E

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000205733
AA Change: D618E

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000205889
AA Change: D618E

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000206643
Predicted Effect probably benign
Transcript: ENSMUST00000206664
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SH2-domain containing mediators family. The encoded protein mediates activation of various kinases and may function in cytokine and growth factor receptor signaling and cellular transformation. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice are infertile. Female mice have small, anovulatory ovaries with reduced numbers of follicles and male mice exhibit small testes and sperm deficits. Mice homozygous for a floxed allele activated in the pancreas exhibit impaired glucose homeostasis when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 A T 12: 84,612,865 F153I possibly damaging Het
Adcy1 G A 11: 7,144,765 V564I probably damaging Het
Apol9b T C 15: 77,735,934 I310T possibly damaging Het
Arhgef28 C A 13: 97,996,862 V366F probably benign Het
B020004C17Rik C T 14: 57,017,316 T199I possibly damaging Het
Carmil2 C T 8: 105,690,835 T575I possibly damaging Het
Catsper1 A T 19: 5,336,663 Q308L unknown Het
Cpa2 T A 6: 30,551,990 S239T probably damaging Het
Ddit3 G A 10: 127,295,907 G108D probably damaging Het
Dnah3 T C 7: 120,029,016 I1473V probably benign Het
Dscam A G 16: 96,643,931 V1520A probably benign Het
Edc4 TAGTAGCAGCAGCAGTAGCAGCAGCAG TAGTAGCAGCAGCAG 8: 105,888,405 probably benign Het
Ednrb T A 14: 103,820,017 I370F probably benign Het
Ehd3 A G 17: 73,827,462 E272G possibly damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam49b A T 15: 63,938,658 probably null Het
Fkbp11 T C 15: 98,724,426 K189E unknown Het
Frem1 T A 4: 82,966,144 E1190D probably benign Het
Gabrg2 A C 11: 41,976,563 Y76* probably null Het
Gm11437 T A 11: 84,167,472 probably benign Het
Gm8947 C A 1: 151,193,096 Q227K probably benign Het
Gm9195 A G 14: 72,480,056 F279S probably damaging Het
Gpbp1l1 T C 4: 116,573,458 I42T probably benign Het
Hdac5 A T 11: 102,197,381 V939E probably null Het
Hivep3 CGG CG 4: 120,097,911 1141 probably null Het
Kitl A T 10: 100,016,081 I21F probably benign Het
Krt1 T C 15: 101,846,872 D484G probably damaging Het
Larp1 C A 11: 58,048,078 P527T probably damaging Het
Lrp5 A G 19: 3,620,085 V673A possibly damaging Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Mmp27 G A 9: 7,577,317 V228M probably damaging Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo15 G T 11: 60,490,915 probably null Het
Myt1 A G 2: 181,782,591 K26E possibly damaging Het
Nek1 T A 8: 61,089,707 I777N probably benign Het
Nlrc5 C T 8: 94,476,393 R374* probably null Het
Nol8 T C 13: 49,661,219 S268P probably benign Het
Nynrin T A 14: 55,870,511 L1025Q probably damaging Het
Olfr1099 A G 2: 86,959,258 S67P probably damaging Het
Osbpl3 A T 6: 50,348,098 L140H probably damaging Het
Pcnt T C 10: 76,400,001 N1382S probably benign Het
Pef1 T A 4: 130,127,385 L244* probably null Het
Phf11a T C 14: 59,280,725 E191G probably benign Het
Polr3a A T 14: 24,467,076 D702E probably damaging Het
Ptch1 C T 13: 63,511,984 G1285D probably benign Het
Ptpn3 T C 4: 57,221,993 D566G probably damaging Het
Pwp2 C T 10: 78,182,480 G126R probably damaging Het
Scgb1b12 T C 7: 32,334,567 I84T probably damaging Het
Slc35f5 T A 1: 125,584,519 V352E probably damaging Het
Sppl2c A G 11: 104,187,604 E410G probably damaging Het
St6galnac2 T C 11: 116,679,979 Y261C probably damaging Het
Stra6 G A 9: 58,151,260 R468Q probably benign Het
Taf3 T C 2: 9,916,377 H924R unknown Het
Tbx18 C A 9: 87,730,697 V50L probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Unc45b C T 11: 82,942,495 T845I probably benign Het
Usp15 T C 10: 123,196,893 D8G possibly damaging Het
Vmn2r91 A G 17: 18,136,278 I736V possibly damaging Het
Vps13c C A 9: 67,914,073 D1288E probably benign Het
Zfp458 T A 13: 67,257,236 M380L probably benign Het
Zfp638 A G 6: 83,929,455 N201D possibly damaging Het
Other mutations in Sh2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02096:Sh2b1 APN 7 126469293 missense probably damaging 0.99
IGL02320:Sh2b1 APN 7 126469169 missense probably benign 0.02
IGL02589:Sh2b1 APN 7 126469268 missense probably benign 0.19
IGL02668:Sh2b1 APN 7 126472474 missense possibly damaging 0.62
IGL03189:Sh2b1 APN 7 126468530 missense possibly damaging 0.61
R0130:Sh2b1 UTSW 7 126471448 missense possibly damaging 0.95
R0532:Sh2b1 UTSW 7 126472272 missense probably benign 0.00
R2081:Sh2b1 UTSW 7 126472690 missense possibly damaging 0.62
R2109:Sh2b1 UTSW 7 126472364 missense possibly damaging 0.74
R2409:Sh2b1 UTSW 7 126471479 missense probably damaging 1.00
R2566:Sh2b1 UTSW 7 126468926 missense probably damaging 0.99
R3752:Sh2b1 UTSW 7 126468787 missense probably damaging 1.00
R4675:Sh2b1 UTSW 7 126471446 missense possibly damaging 0.79
R4970:Sh2b1 UTSW 7 126468803 missense probably damaging 1.00
R5102:Sh2b1 UTSW 7 126471236 missense probably benign
R5912:Sh2b1 UTSW 7 126471470 missense probably damaging 1.00
R7694:Sh2b1 UTSW 7 126467757 missense probably benign 0.03
R7801:Sh2b1 UTSW 7 126471292 missense probably benign 0.15
R8005:Sh2b1 UTSW 7 126469307 missense possibly damaging 0.82
R8353:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R8356:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R8453:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R8456:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R8456:Sh2b1 UTSW 7 126467600 nonsense probably null
R8683:Sh2b1 UTSW 7 126467571 utr 3 prime probably benign
R8906:Sh2b1 UTSW 7 126471120 critical splice donor site probably null
R8921:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R8921:Sh2b1 UTSW 7 126467581 utr 3 prime probably benign
R8922:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R9000:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R9000:Sh2b1 UTSW 7 126467571 utr 3 prime probably benign
R9000:Sh2b1 UTSW 7 126467599 utr 3 prime probably benign
R9048:Sh2b1 UTSW 7 126467574 utr 3 prime probably benign
R9048:Sh2b1 UTSW 7 126467594 utr 3 prime probably benign
Z1176:Sh2b1 UTSW 7 126467731 missense probably benign 0.23
Z1177:Sh2b1 UTSW 7 126471123 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAATGGAATGGGAATGCAGC -3'
(R):5'- GGGACTTTAACTCCCACCTCAC -3'

Sequencing Primer
(F):5'- AGGAGCCTCTGCCTGCATC -3'
(R):5'- ACTTGTCATCCTGCCCTCAG -3'
Posted On2019-09-13