Incidental Mutation 'R8377:Rfxank'
ID646751
Institutional Source Beutler Lab
Gene Symbol Rfxank
Ensembl Gene ENSMUSG00000036120
Gene Nameregulatory factor X-associated ankyrin-containing protein
SynonymsTvl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8377 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location70130794-70139154 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70135310 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 149 (V149D)
Ref Sequence ENSEMBL: ENSMUSP00000148739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002418] [ENSMUST00000075724] [ENSMUST00000095273] [ENSMUST00000110139] [ENSMUST00000123760] [ENSMUST00000129668] [ENSMUST00000163756] [ENSMUST00000211898] [ENSMUST00000212320]
Predicted Effect probably benign
Transcript: ENSMUST00000002418
SMART Domains Protein: ENSMUSP00000002418
Gene: ENSMUSG00000002345

DomainStartEndE-ValueType
Pfam:NEP 1 119 1.7e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000075724
AA Change: V139D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075140
Gene: ENSMUSG00000036120
AA Change: V139D

DomainStartEndE-ValueType
ANK 132 161 1.36e-2 SMART
ANK 165 194 5.16e-3 SMART
ANK 198 227 7.42e-4 SMART
ANK 231 260 2.35e3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095273
SMART Domains Protein: ENSMUSP00000092907
Gene: ENSMUSG00000071078

DomainStartEndE-ValueType
SCOP:d1jhja_ 22 64 6e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110139
SMART Domains Protein: ENSMUSP00000105766
Gene: ENSMUSG00000002345

DomainStartEndE-ValueType
Pfam:NEP 1 107 2.1e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123760
SMART Domains Protein: ENSMUSP00000118102
Gene: ENSMUSG00000002345

DomainStartEndE-ValueType
Pfam:NEP 1 78 2.4e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129668
SMART Domains Protein: ENSMUSP00000137694
Gene: ENSMUSG00000002345

DomainStartEndE-ValueType
Pfam:NEP 1 78 2.4e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163756
SMART Domains Protein: ENSMUSP00000132314
Gene: ENSMUSG00000079033

DomainStartEndE-ValueType
MADS 1 60 3.15e-34 SMART
low complexity region 97 114 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
low complexity region 320 335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211898
Predicted Effect probably damaging
Transcript: ENSMUST00000212320
AA Change: V149D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Major histocompatibility (MHC) class II molecules are transmembrane proteins that have a central role in development and control of the immune system. The protein encoded by this gene, along with regulatory factor X-associated protein and regulatory factor-5, forms a complex that binds to the X box motif of certain MHC class II gene promoters and activates their transcription. Once bound to the promoter, this complex associates with the non-DNA-binding factor MHC class II transactivator, which controls the cell type specificity and inducibility of MHC class II gene expression. This protein contains ankyrin repeats involved in protein-protein interactions. Mutations in this gene have been linked to bare lymphocyte syndrome type II, complementation group B. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
Acot3 C A 12: 84,058,787 C251* probably null Het
Acsbg1 A G 9: 54,622,505 C273R probably damaging Het
Adh6a A G 3: 138,326,123 T259A probably damaging Het
Aknad1 A G 3: 108,781,939 H639R possibly damaging Het
Alkal2 G T 12: 30,884,851 G23V probably damaging Het
Ampd3 A G 7: 110,800,730 R342G probably damaging Het
Arid5b G T 10: 68,097,387 A895E probably damaging Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Bmp8a G T 4: 123,342,689 P7Q unknown Het
Boll A C 1: 55,323,678 V187G possibly damaging Het
Ccdc162 A T 10: 41,581,310 C1544S probably benign Het
Cmss1 A C 16: 57,307,394 M182R possibly damaging Het
Cntn3 T C 6: 102,209,293 M578V probably benign Het
Dmxl2 A T 9: 54,378,748 W2718R probably damaging Het
Dsg1a T A 18: 20,333,774 I567N probably damaging Het
Epc2 T A 2: 49,522,515 D168E probably damaging Het
Ern2 G A 7: 122,181,292 Q162* probably null Het
F11r G T 1: 171,437,543 probably benign Het
Fam196b C A 11: 34,401,964 A2D probably damaging Het
Fcgrt T C 7: 45,102,563 Y59C probably damaging Het
Fmn2 G T 1: 174,608,445 E661* probably null Het
Gbp4 T A 5: 105,118,462 Q571L probably benign Het
Gm29106 A T 1: 118,198,863 H95L probably damaging Het
Gphn G A 12: 78,664,506 V621M probably damaging Het
Grwd1 T C 7: 45,830,612 Y57C probably damaging Het
Irs2 G A 8: 11,004,848 Q1195* probably null Het
Itpr1 G C 6: 108,510,738 C2375S probably benign Het
Kcnmb4 A T 10: 116,446,385 Y136N probably benign Het
Matn2 C T 15: 34,345,365 P173S probably damaging Het
Med17 A C 9: 15,262,359 D606E probably damaging Het
Mpl A G 4: 118,444,057 V537A Het
Mrpl1 C G 5: 96,226,367 A167G probably benign Het
Mrpl21 T C 19: 3,292,487 F206S unknown Het
Msh6 T A 17: 87,985,170 M451K probably damaging Het
Myo10 T C 15: 25,804,395 I1592T possibly damaging Het
Naip1 A T 13: 100,425,866 D930E possibly damaging Het
Necap2 T C 4: 141,068,223 I242V probably benign Het
Nfya A G 17: 48,392,045 V240A possibly damaging Het
Olfml2b A G 1: 170,668,784 D328G probably damaging Het
Olfr1277 T A 2: 111,269,638 H243L probably damaging Het
Olfr1337 A T 4: 118,782,006 M193K probably benign Het
Olfr1449 T G 19: 12,935,035 V99G probably benign Het
Olfr473 T G 7: 107,933,685 L55R probably damaging Het
Pkd1l3 T C 8: 109,635,350 V1018A probably benign Het
Plcg1 T C 2: 160,754,922 L761P probably damaging Het
Ppp1r36 T C 12: 76,438,441 S313P possibly damaging Het
Ptpru C A 4: 131,808,335 G444C probably damaging Het
Rimbp2 G A 5: 128,780,331 H819Y probably damaging Het
Sgms1 T C 19: 32,124,421 Y395C probably damaging Het
Siae G A 9: 37,631,605 probably null Het
Slc46a2 T A 4: 59,914,713 D70V probably damaging Het
Smpdl3a A C 10: 57,800,936 L43F possibly damaging Het
Spcs1 T A 14: 31,000,146 D146V possibly damaging Het
Srcin1 T C 11: 97,551,978 D8G probably damaging Het
Stra6 G T 9: 58,149,205 L373F probably damaging Het
Tacc1 A T 8: 25,182,283 S310T possibly damaging Het
Tlr12 T C 4: 128,615,773 S895G probably benign Het
Tnfaip3 A G 10: 19,011,510 V89A probably damaging Het
Top1 C T 2: 160,646,089 probably benign Het
Trappc13 T G 13: 104,161,001 I132L probably benign Het
Trpt1 C T 19: 6,998,981 Q249* probably null Het
Tsnaxip1 A C 8: 105,842,547 K510Q probably damaging Het
Usp39 A T 6: 72,328,674 N375K probably benign Het
Vldlr T A 19: 27,234,858 C91S probably damaging Het
Vmn1r232 T A 17: 20,913,977 L120F probably benign Het
Vmn2r71 T C 7: 85,615,499 V13A probably benign Het
Wdr11 T A 7: 129,606,688 V389E possibly damaging Het
Wsb2 A T 5: 117,376,701 I321F possibly damaging Het
Zan A T 5: 137,391,687 V4841E unknown Het
Zfy1 A T Y: 725,723 F681I possibly damaging Het
Zpld1 C A 16: 55,246,654 E179D probably benign Het
Other mutations in Rfxank
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1576:Rfxank UTSW 8 70134303 missense possibly damaging 0.95
R4303:Rfxank UTSW 8 70136212 missense probably damaging 1.00
R7033:Rfxank UTSW 8 70138170 missense probably benign
R7355:Rfxank UTSW 8 70135307 missense probably damaging 1.00
R7385:Rfxank UTSW 8 70134635 missense probably damaging 1.00
R7399:Rfxank UTSW 8 70135286 splice site probably null
R8218:Rfxank UTSW 8 70131435 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACCCATACTGGCAAGTGAC -3'
(R):5'- AACTTGTGCGTGAGAGTGGC -3'

Sequencing Primer
(F):5'- AAGTGACAGTGCGCTCTC -3'
(R):5'- CATGTATGATTTGTGTAATGTTCCCC -3'
Posted On2020-09-02