Mutagenetix > Incidental Mutation

Incidental Mutation 'R7914:Cnot1'

647962

Institutional Source

Beutler Lab

Gene Symbol

Cnot1

Ensembl Gene

ENSMUSG00000036550

Gene Name

CCR4-NOT transcription complex, subunit 1

Synonyms

6030411K04Rik

MMRRC Submission

045962-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7914 (G1)

Quality Score

152.468

Status

Validated

Chromosome

Chromosomal Location

96446079-96534092 bp(-) (GRCm39)

Type of Mutation

frame shift

DNA Base Change (assembly)

ACG to A at 96472275 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000063565 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006] [ENSMUST00000213046]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000068452

SMART Domains

Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
PDB:4J8S\|A	798	999	1e-137	PDB
low complexity region	1011	1028	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
PDB:4CT4\|C	1056	1295	1e-148	PDB
low complexity region	1296	1308	N/A	INTRINSIC
low complexity region	1328	1345	N/A	INTRINSIC
Pfam:DUF3819	1381	1530	2.5e-56	PFAM
low complexity region	1634	1648	N/A	INTRINSIC
Pfam:Not1	1991	2305	2.4e-125	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000098473
AA Change: 1188

SMART Domains

Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: 1188

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
Pfam:CNOT1_HEAT	500	656	2.4e-57	PFAM
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
Pfam:CNOT1_TTP_bind	812	1004	1.4e-87	PFAM
low complexity region	1016	1033	N/A	INTRINSIC
low complexity region	1036	1060	N/A	INTRINSIC
Pfam:CNOT1_CAF1_bind	1087	1313	5.7e-99	PFAM
low complexity region	1333	1350	N/A	INTRINSIC
Pfam:DUF3819	1387	1534	2.3e-57	PFAM
low complexity region	1639	1653	N/A	INTRINSIC
Pfam:Not1	1998	2357	5.7e-157	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000211887

Predicted Effect

probably null
Transcript: ENSMUST00000211973

Predicted Effect

probably null
Transcript: ENSMUST00000213006

Predicted Effect

probably benign
Transcript: ENSMUST00000213046

Meta Mutation Damage Score

0.9756

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (39/39)

MGI Phenotype

PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	G	T	10: 100,428,538 (GRCm39)	V12F	probably benign	Het
Adnp2	T	A	18: 80,174,056 (GRCm39)	R118W	probably damaging	Het
Apaf1	G	A	10: 90,896,095 (GRCm39)	R337C	probably damaging	Het
Arhgef40	T	C	14: 52,225,032 (GRCm39)	L59P	probably damaging	Het
B020011L13Rik	A	G	1: 117,729,162 (GRCm39)	E223G	probably benign	Het
Bcl6	T	C	16: 23,788,761 (GRCm39)	R536G	possibly damaging	Het
Bltp1	A	T	3: 37,000,432 (GRCm39)	N1204Y	probably benign	Het
Catsperg1	T	C	7: 28,894,851 (GRCm39)	E582G	probably benign	Het
Ccdc136	A	G	6: 29,419,306 (GRCm39)	N942S	probably damaging	Het
Ccdc81	A	C	7: 89,524,988 (GRCm39)	M531R	possibly damaging	Het
Cep78	T	C	19: 15,953,672 (GRCm39)	E283G	probably benign	Het
E230025N22Rik	C	A	18: 36,828,605 (GRCm39)	R24S	possibly damaging	Het
Epb41l1	T	A	2: 156,364,128 (GRCm39)	M879K	probably benign	Het
Fam135a	T	C	1: 24,065,760 (GRCm39)	Y1226C	probably damaging	Het
Fbxo11	T	C	17: 88,320,031 (GRCm39)	E151G		Het
Herc6	A	G	6: 57,584,106 (GRCm39)	T322A	probably benign	Het
Inka1	T	C	9: 107,862,761 (GRCm39)		probably benign	Het
Kalrn	T	A	16: 33,849,122 (GRCm39)	Q2110L	probably benign	Het
Kti12	A	C	4: 108,705,443 (GRCm39)	E119A	probably benign	Het
Kti12	G	T	4: 108,705,444 (GRCm39)	E119D	probably benign	Het
Lrrc19	T	A	4: 94,526,537 (GRCm39)	H340L	probably damaging	Het
Mkks	A	T	2: 136,722,876 (GRCm39)	F94I	probably damaging	Het
Pcdhga3	T	A	18: 37,808,013 (GRCm39)	F155L	probably benign	Het
Pdlim1	T	A	19: 40,240,445 (GRCm39)	I53F	probably damaging	Het
Pttg1	A	T	11: 43,316,421 (GRCm39)	L26Q	probably benign	Het
Rasa4	T	A	5: 136,130,510 (GRCm39)		probably benign	Het
Rsbn1l	A	G	5: 21,110,896 (GRCm39)	S481P	probably damaging	Het
Sae1	C	A	7: 16,121,648 (GRCm39)	G10C	unknown	Het
Samd15	T	C	12: 87,248,559 (GRCm39)	S415P	probably damaging	Het
Scn7a	T	A	2: 66,530,294 (GRCm39)	I684F	probably damaging	Het
Sec23b	T	A	2: 144,406,565 (GRCm39)	M120K	probably benign	Het
Slc20a1	G	A	2: 129,049,757 (GRCm39)	D340N	probably benign	Het
Slf2	T	A	19: 44,947,499 (GRCm39)	M821K	possibly damaging	Het
Suv39h2	G	A	2: 3,465,453 (GRCm39)	R301*	probably null	Het
Tgfbi	A	G	13: 56,777,502 (GRCm39)	T329A	probably damaging	Het
Tmprss12	T	C	15: 100,183,111 (GRCm39)	F151S	probably damaging	Het
Ttn	T	C	2: 76,747,525 (GRCm39)	D4508G	probably benign	Het
Tyk2	C	A	9: 21,032,851 (GRCm39)	C304F	probably benign	Het
Vmn1r121	T	A	7: 20,831,589 (GRCm39)	T284S	probably benign	Het
Vmn2r117	A	G	17: 23,679,100 (GRCm39)	I708T	possibly damaging	Het
Vmn2r2	A	T	3: 64,041,526 (GRCm39)	D396E	probably benign	Het
Zfc3h1	A	G	10: 115,239,062 (GRCm39)		probably null	Het
Zic4	T	G	9: 91,266,181 (GRCm39)	V275G	probably damaging	Het

Other mutations in Cnot1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Cnot1	APN	8	96,452,707 (GRCm39)	missense	probably damaging	1.00
IGL01340:Cnot1	APN	8	96,487,165 (GRCm39)	missense	probably damaging	1.00
IGL01457:Cnot1	APN	8	96,467,637 (GRCm39)	missense	probably damaging	1.00
IGL01505:Cnot1	APN	8	96,455,346 (GRCm39)	missense	probably damaging	0.98
IGL02401:Cnot1	APN	8	96,482,761 (GRCm39)	missense	possibly damaging	0.95
IGL02693:Cnot1	APN	8	96,500,113 (GRCm39)	missense	probably damaging	1.00
IGL02696:Cnot1	APN	8	96,471,645 (GRCm39)	missense	probably benign	0.00
IGL02754:Cnot1	APN	8	96,481,706 (GRCm39)	missense	probably benign	0.03
IGL03092:Cnot1	APN	8	96,496,243 (GRCm39)	intron	probably benign
IGL03174:Cnot1	APN	8	96,487,983 (GRCm39)	missense	probably damaging	1.00
IGL03310:Cnot1	APN	8	96,462,308 (GRCm39)	splice site	probably benign
IGL03371:Cnot1	APN	8	96,501,344 (GRCm39)	missense	possibly damaging	0.85
Affiliate	UTSW	8	96,491,753 (GRCm39)	missense	probably damaging	0.99
Barge	UTSW	8	96,460,757 (GRCm39)	missense	probably benign	0.13
Byproduct	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
Chairman	UTSW	8	96,491,655 (GRCm39)	missense	possibly damaging	0.95
cohort	UTSW	8	96,462,377 (GRCm39)	missense	probably damaging	0.99
Director	UTSW	8	96,491,690 (GRCm39)	missense	probably benign	0.15
kowloon	UTSW	8	96,515,286 (GRCm39)	missense	probably damaging	1.00
Quorum	UTSW	8	96,452,746 (GRCm39)	missense	probably damaging	1.00
tugboat	UTSW	8	96,500,246 (GRCm39)	missense	probably damaging	0.99
Xiao	UTSW	8	96,457,048 (GRCm39)	missense	probably damaging	1.00
BB001:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
BB003:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
BB011:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
BB013:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
R0008:Cnot1	UTSW	8	96,487,969 (GRCm39)	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	96,487,969 (GRCm39)	missense	probably damaging	1.00
R0091:Cnot1	UTSW	8	96,489,772 (GRCm39)	missense	probably damaging	1.00
R0335:Cnot1	UTSW	8	96,498,628 (GRCm39)	missense	probably benign	0.02
R0409:Cnot1	UTSW	8	96,475,483 (GRCm39)	missense	probably damaging	0.96
R0445:Cnot1	UTSW	8	96,486,836 (GRCm39)	missense	probably damaging	1.00
R1505:Cnot1	UTSW	8	96,455,295 (GRCm39)	missense	probably damaging	1.00
R1517:Cnot1	UTSW	8	96,469,841 (GRCm39)	missense	probably benign	0.38
R1640:Cnot1	UTSW	8	96,496,460 (GRCm39)	missense	probably damaging	0.98
R1737:Cnot1	UTSW	8	96,474,904 (GRCm39)	missense	probably damaging	0.98
R1755:Cnot1	UTSW	8	96,451,205 (GRCm39)	missense	probably damaging	1.00
R1901:Cnot1	UTSW	8	96,469,749 (GRCm39)	missense	possibly damaging	0.50
R1902:Cnot1	UTSW	8	96,469,749 (GRCm39)	missense	possibly damaging	0.50
R1903:Cnot1	UTSW	8	96,469,749 (GRCm39)	missense	possibly damaging	0.50
R1988:Cnot1	UTSW	8	96,468,572 (GRCm39)	missense	possibly damaging	0.89
R2051:Cnot1	UTSW	8	96,451,221 (GRCm39)	missense	possibly damaging	0.47
R2054:Cnot1	UTSW	8	96,466,469 (GRCm39)	missense	possibly damaging	0.55
R2072:Cnot1	UTSW	8	96,466,461 (GRCm39)	missense	possibly damaging	0.89
R2074:Cnot1	UTSW	8	96,466,461 (GRCm39)	missense	possibly damaging	0.89
R2075:Cnot1	UTSW	8	96,466,461 (GRCm39)	missense	possibly damaging	0.89
R2093:Cnot1	UTSW	8	96,501,986 (GRCm39)	missense	probably damaging	1.00
R2116:Cnot1	UTSW	8	96,452,781 (GRCm39)	missense	probably damaging	1.00
R2191:Cnot1	UTSW	8	96,488,054 (GRCm39)	missense	probably damaging	0.98
R2238:Cnot1	UTSW	8	96,496,149 (GRCm39)	missense	probably benign	0.04
R2239:Cnot1	UTSW	8	96,496,149 (GRCm39)	missense	probably benign	0.04
R2251:Cnot1	UTSW	8	96,489,814 (GRCm39)	missense	probably benign	0.00
R2252:Cnot1	UTSW	8	96,489,814 (GRCm39)	missense	probably benign	0.00
R2253:Cnot1	UTSW	8	96,489,814 (GRCm39)	missense	probably benign	0.00
R2315:Cnot1	UTSW	8	96,475,690 (GRCm39)	missense	probably damaging	1.00
R2431:Cnot1	UTSW	8	96,501,280 (GRCm39)	missense	probably damaging	1.00
R2988:Cnot1	UTSW	8	96,470,906 (GRCm39)	missense	possibly damaging	0.80
R2989:Cnot1	UTSW	8	96,470,906 (GRCm39)	missense	possibly damaging	0.80
R3108:Cnot1	UTSW	8	96,462,377 (GRCm39)	missense	probably damaging	0.99
R3109:Cnot1	UTSW	8	96,462,377 (GRCm39)	missense	probably damaging	0.99
R3114:Cnot1	UTSW	8	96,470,906 (GRCm39)	missense	possibly damaging	0.80
R3115:Cnot1	UTSW	8	96,470,906 (GRCm39)	missense	possibly damaging	0.80
R3153:Cnot1	UTSW	8	96,470,906 (GRCm39)	missense	possibly damaging	0.80
R3154:Cnot1	UTSW	8	96,470,906 (GRCm39)	missense	possibly damaging	0.80
R4112:Cnot1	UTSW	8	96,500,246 (GRCm39)	missense	probably damaging	0.99
R4359:Cnot1	UTSW	8	96,466,476 (GRCm39)	missense	probably damaging	1.00
R4382:Cnot1	UTSW	8	96,496,407 (GRCm39)	missense	probably damaging	0.97
R4747:Cnot1	UTSW	8	96,501,310 (GRCm39)	missense	probably benign	0.27
R4910:Cnot1	UTSW	8	96,459,859 (GRCm39)	missense	probably benign	0.43
R4913:Cnot1	UTSW	8	96,489,695 (GRCm39)	missense	possibly damaging	0.63
R4971:Cnot1	UTSW	8	96,448,254 (GRCm39)	missense	probably damaging	1.00
R5056:Cnot1	UTSW	8	96,467,636 (GRCm39)	missense	probably damaging	1.00
R5092:Cnot1	UTSW	8	96,479,396 (GRCm39)	missense	possibly damaging	0.91
R5101:Cnot1	UTSW	8	96,486,815 (GRCm39)	missense	possibly damaging	0.90
R5498:Cnot1	UTSW	8	96,483,983 (GRCm39)	missense	possibly damaging	0.92
R5719:Cnot1	UTSW	8	96,470,924 (GRCm39)	missense	possibly damaging	0.92
R5850:Cnot1	UTSW	8	96,460,775 (GRCm39)	nonsense	probably null
R5956:Cnot1	UTSW	8	96,481,606 (GRCm39)	critical splice donor site	probably null
R5981:Cnot1	UTSW	8	96,515,293 (GRCm39)	missense	probably damaging	1.00
R6093:Cnot1	UTSW	8	96,475,522 (GRCm39)	missense	probably benign	0.03
R6108:Cnot1	UTSW	8	96,457,048 (GRCm39)	missense	probably damaging	1.00
R6261:Cnot1	UTSW	8	96,468,549 (GRCm39)	missense	probably benign	0.00
R6632:Cnot1	UTSW	8	96,499,895 (GRCm39)	intron	probably benign
R6882:Cnot1	UTSW	8	96,447,054 (GRCm39)	missense	possibly damaging	0.85
R6966:Cnot1	UTSW	8	96,451,160 (GRCm39)	missense	probably damaging	1.00
R6985:Cnot1	UTSW	8	96,460,757 (GRCm39)	missense	probably benign	0.13
R7210:Cnot1	UTSW	8	96,515,286 (GRCm39)	missense	probably damaging	1.00
R7410:Cnot1	UTSW	8	96,459,787 (GRCm39)	missense	possibly damaging	0.77
R7623:Cnot1	UTSW	8	96,454,276 (GRCm39)	missense	probably damaging	1.00
R7624:Cnot1	UTSW	8	96,478,447 (GRCm39)	missense	probably damaging	1.00
R7695:Cnot1	UTSW	8	96,497,260 (GRCm39)	missense	probably benign	0.03
R7703:Cnot1	UTSW	8	96,486,726 (GRCm39)	critical splice donor site	probably null
R7771:Cnot1	UTSW	8	96,491,753 (GRCm39)	missense	probably damaging	0.99
R7800:Cnot1	UTSW	8	96,491,690 (GRCm39)	missense	probably benign	0.15
R7809:Cnot1	UTSW	8	96,478,406 (GRCm39)	missense	probably damaging	1.00
R7857:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
R7924:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
R7926:Cnot1	UTSW	8	96,472,275 (GRCm39)	frame shift	probably null
R7981:Cnot1	UTSW	8	96,489,797 (GRCm39)	missense	probably damaging	1.00
R8004:Cnot1	UTSW	8	96,479,380 (GRCm39)	missense	probably benign	0.03
R8061:Cnot1	UTSW	8	96,491,655 (GRCm39)	missense	possibly damaging	0.95
R8185:Cnot1	UTSW	8	96,487,979 (GRCm39)	missense	probably damaging	1.00
R8269:Cnot1	UTSW	8	96,478,389 (GRCm39)	missense	probably damaging	1.00
R8306:Cnot1	UTSW	8	96,473,649 (GRCm39)	missense	probably benign	0.05
R8322:Cnot1	UTSW	8	96,496,472 (GRCm39)	missense	probably benign	0.00
R8427:Cnot1	UTSW	8	96,460,952 (GRCm39)	missense	probably benign	0.01
R8723:Cnot1	UTSW	8	96,462,907 (GRCm39)	missense	probably benign	0.00
R8934:Cnot1	UTSW	8	96,491,695 (GRCm39)	missense	probably benign	0.04
R9025:Cnot1	UTSW	8	96,475,660 (GRCm39)	missense	probably benign
R9179:Cnot1	UTSW	8	96,500,054 (GRCm39)	missense	probably benign	0.16
R9280:Cnot1	UTSW	8	96,497,227 (GRCm39)	missense	probably benign	0.15
R9285:Cnot1	UTSW	8	96,452,746 (GRCm39)	missense	probably damaging	1.00
R9299:Cnot1	UTSW	8	96,468,448 (GRCm39)	missense	probably damaging	1.00
R9337:Cnot1	UTSW	8	96,468,448 (GRCm39)	missense	probably damaging	1.00
R9480:Cnot1	UTSW	8	96,497,338 (GRCm39)	missense	possibly damaging	0.94
R9548:Cnot1	UTSW	8	96,482,854 (GRCm39)	missense	probably benign	0.02
R9601:Cnot1	UTSW	8	96,482,835 (GRCm39)	missense	probably benign	0.02
R9629:Cnot1	UTSW	8	96,455,874 (GRCm39)	missense	probably damaging	0.98
R9752:Cnot1	UTSW	8	96,488,019 (GRCm39)	missense	probably damaging	1.00
R9764:Cnot1	UTSW	8	96,496,209 (GRCm39)	missense	probably benign	0.00
R9789:Cnot1	UTSW	8	96,455,772 (GRCm39)	missense	probably damaging	1.00
X0050:Cnot1	UTSW	8	96,469,726 (GRCm39)	splice site	probably null
Z1176:Cnot1	UTSW	8	96,474,905 (GRCm39)	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- AGCACACCCACTGGCTTTTC -3'
(R):5'- TACACGGGATAGGTCTGCTTTG -3'

Sequencing Primer
(F):5'- GGCTTTTCTGTATCCTAAAAGAGCC -3'
(R):5'- GGGTAGGTGCTCAGAATTGATTTC -3'

Posted On

2020-09-15