Incidental Mutation 'R8356:Trim34a'
ID 660335
Institutional Source Beutler Lab
Gene Symbol Trim34a
Ensembl Gene ENSMUSG00000056144
Gene Name tripartite motif-containing 34A
Synonyms Trim34-1, Trim34
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R8356 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 104244457-104262234 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 104260971 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 327 (I327F)
Ref Sequence ENSEMBL: ENSMUSP00000102462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051795] [ENSMUST00000060315] [ENSMUST00000098179] [ENSMUST00000106848] [ENSMUST00000106849]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000051795
SMART Domains Protein: ENSMUSP00000050084
Gene: ENSMUSG00000060441

DomainStartEndE-ValueType
RING 15 58 3.64e-7 SMART
BBOX 91 132 4.83e-12 SMART
coiled coil region 172 232 N/A INTRINSIC
Pfam:SPRY 349 485 9.2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000060315
AA Change: I327F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000055058
Gene: ENSMUSG00000056144
AA Change: I327F

DomainStartEndE-ValueType
RING 15 58 6.79e-7 SMART
BBOX 91 132 1.08e-9 SMART
coiled coil region 194 238 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 347 474 1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098179
SMART Domains Protein: ENSMUSP00000095781
Gene: ENSMUSG00000060441

DomainStartEndE-ValueType
RING 15 58 3.64e-7 SMART
BBOX 91 132 4.83e-12 SMART
Pfam:SPRY 351 493 1.6e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106848
AA Change: I327F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102461
Gene: ENSMUSG00000056144
AA Change: I327F

DomainStartEndE-ValueType
RING 15 58 6.79e-7 SMART
BBOX 91 132 1.08e-9 SMART
coiled coil region 194 238 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 345 484 6.5e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106849
AA Change: I327F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102462
Gene: ENSMUSG00000056144
AA Change: I327F

DomainStartEndE-ValueType
RING 15 58 6.79e-7 SMART
BBOX 91 132 1.08e-9 SMART
coiled coil region 194 238 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 345 484 6.5e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik T A 5: 113,723,807 M1L unknown Het
AA792892 A G 5: 94,383,844 K196E probably damaging Het
Abcc9 A T 6: 142,590,370 M1546K probably benign Het
Acbd3 T C 1: 180,726,316 M72T probably benign Het
Adam6a T G 12: 113,546,137 L710R probably benign Het
Aldh4a1 T C 4: 139,638,522 S275P probably benign Het
Ap3d1 A T 10: 80,732,903 L47Q probably damaging Het
Arhgap19 G A 19: 41,774,176 R414C probably damaging Het
Ascc3 T C 10: 50,649,907 S572P probably benign Het
Cdk10 G A 8: 123,228,357 R78H probably benign Het
Celsr2 C T 3: 108,413,531 R655H possibly damaging Het
Cntnap2 T A 6: 47,049,373 H44Q probably benign Het
Cpped1 A T 16: 11,894,929 C32* probably null Het
Ddi1 A G 9: 6,266,249 V40A probably benign Het
Ddx50 T C 10: 62,621,508 T588A probably benign Het
Degs2 A G 12: 108,691,964 I252T possibly damaging Het
Dnah1 C T 14: 31,273,015 V2762I probably benign Het
Dnah5 A G 15: 28,444,167 D4037G probably benign Het
Dnah5 C T 15: 28,444,323 A4089V probably null Het
Dthd1 A T 5: 62,849,738 D594V probably damaging Het
Ehmt1 A T 2: 24,852,769 M466K probably benign Het
Erich2 A T 2: 70,527,529 probably null Het
Fam129a T A 1: 151,696,150 V282D probably damaging Het
Fam221b T C 4: 43,665,519 D313G probably benign Het
Fbxl22 T C 9: 66,514,450 D35G possibly damaging Het
Ggcx A G 6: 72,429,591 E679G probably benign Het
Gm14295 A G 2: 176,809,514 T266A probably benign Het
Hnrnpa1 A G 15: 103,242,102 D160G probably null Het
Hnrnpul1 T C 7: 25,722,822 probably benign Het
Hydin A G 8: 110,533,124 E2576G possibly damaging Het
Ifit2 T A 19: 34,573,508 C149* probably null Het
Il18rap T A 1: 40,524,924 S67R probably benign Het
Kcnk4 T G 19: 6,926,300 S294R probably benign Het
Kif21b A G 1: 136,172,945 H1588R probably damaging Het
Klhl35 A T 7: 99,472,922 S77C probably damaging Het
Lats2 A T 14: 57,697,410 M228K probably damaging Het
Lrfn4 T C 19: 4,612,228 D587G probably benign Het
Lrrd1 C A 5: 3,866,509 T842K probably benign Het
Mafb G A 2: 160,366,205 H158Y probably benign Het
Mapk8ip3 T A 17: 24,904,951 E561D probably damaging Het
Mcemp1 A G 8: 3,667,542 T158A probably damaging Het
Mst1r A T 9: 107,917,264 E1214V probably damaging Het
Muc16 A G 9: 18,658,778 I815T unknown Het
Ncoa6 T A 2: 155,406,252 I1711L possibly damaging Het
Neo1 G A 9: 58,878,119 T1408M probably damaging Het
Nnt A C 13: 119,339,832 F632C probably damaging Het
Nup210 G A 6: 91,074,348 T351I probably benign Het
Olfr1312 A G 2: 112,042,598 S145P probably damaging Het
Olfr670 A G 7: 104,960,727 S2P probably benign Het
P4ha1 C T 10: 59,355,363 T364I probably damaging Het
Pcdhb11 T A 18: 37,422,199 L194Q probably damaging Het
Rad51ap1 A G 6: 126,924,916 probably null Het
Rbm11 G A 16: 75,600,806 R208K probably benign Het
Rps6ka1 T A 4: 133,860,057 Q535L possibly damaging Het
Slc26a3 A G 12: 31,466,506 D621G probably benign Het
Sox10 T G 15: 79,156,452 E296A probably damaging Het
St3gal4 A C 9: 35,053,142 V188G probably damaging Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Zc2hc1c A G 12: 85,290,697 E376G probably damaging Het
Zfp423 G A 8: 87,783,282 P77S probably damaging Het
Zfp560 A T 9: 20,348,935 S210R probably benign Het
Other mutations in Trim34a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Trim34a APN 7 104261331 missense probably damaging 1.00
IGL00826:Trim34a APN 7 104260933 splice site probably null
IGL01526:Trim34a APN 7 104260499 missense probably damaging 1.00
IGL01859:Trim34a APN 7 104260942 missense probably damaging 0.96
IGL02052:Trim34a APN 7 104247831 missense probably benign 0.33
IGL02192:Trim34a APN 7 104247732 start codon destroyed probably null 1.00
IGL02351:Trim34a APN 7 104261234 nonsense probably null
IGL02358:Trim34a APN 7 104261234 nonsense probably null
IGL03326:Trim34a APN 7 104261380 missense probably benign 0.03
IGL03366:Trim34a APN 7 104260933 splice site probably null
Gold_belt UTSW 7 104261064 nonsense probably null
PIT4472001:Trim34a UTSW 7 104247948 missense probably damaging 1.00
PIT4791001:Trim34a UTSW 7 104260484 missense probably benign 0.15
R0115:Trim34a UTSW 7 104247902 missense probably damaging 1.00
R0848:Trim34a UTSW 7 104261124 missense probably benign
R1016:Trim34a UTSW 7 104247960 missense probably benign 0.10
R1477:Trim34a UTSW 7 104248080 missense possibly damaging 0.81
R1622:Trim34a UTSW 7 104261338 splice site probably null
R2287:Trim34a UTSW 7 104261055 missense probably damaging 1.00
R3685:Trim34a UTSW 7 104260126 splice site probably null
R4166:Trim34a UTSW 7 104261016 missense probably benign 0.02
R4967:Trim34a UTSW 7 104261064 nonsense probably null
R4979:Trim34a UTSW 7 104247862 missense probably benign 0.00
R5194:Trim34a UTSW 7 104260993 missense possibly damaging 0.70
R5443:Trim34a UTSW 7 104260213 missense possibly damaging 0.80
R5631:Trim34a UTSW 7 104248739 missense probably damaging 1.00
R5902:Trim34a UTSW 7 104261121 nonsense probably null
R6147:Trim34a UTSW 7 104261191 missense probably damaging 0.99
R6644:Trim34a UTSW 7 104261037 missense probably damaging 1.00
R7971:Trim34a UTSW 7 104247818 missense probably damaging 0.98
R8060:Trim34a UTSW 7 104260976 missense probably damaging 1.00
R8278:Trim34a UTSW 7 104249416 missense probably damaging 0.99
R9275:Trim34a UTSW 7 104260994 missense probably damaging 0.96
R9563:Trim34a UTSW 7 104261121 nonsense probably null
X0023:Trim34a UTSW 7 104259415 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- TCTAAGCTCTCCAGTGTTGGC -3'
(R):5'- GCTGTAACCCTATAACCCAGTAGC -3'

Sequencing Primer
(F):5'- GGCTTTTCACAGTGTTTCACAAAC -3'
(R):5'- ATAACCCAGTAGCCATTCTGTG -3'
Posted On 2021-01-18