Incidental Mutation 'R8356:Mst1r'
ID660347
Institutional Source Beutler Lab
Gene Symbol Mst1r
Ensembl Gene ENSMUSG00000032584
Gene Namemacrophage stimulating 1 receptor (c-met-related tyrosine kinase)
SynonymsFv-2, Ron, CDw136, Fv2, friend virus susceptibility 2, PTK8, STK
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R8356 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location107906873-107920383 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107917264 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 1214 (E1214V)
Ref Sequence ENSEMBL: ENSMUSP00000035203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035203] [ENSMUST00000195617]
Predicted Effect probably damaging
Transcript: ENSMUST00000035203
AA Change: E1214V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035203
Gene: ENSMUSG00000032584
AA Change: E1214V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 57 510 9.03e-116 SMART
PSI 528 570 8.72e-4 SMART
IPT 570 684 1.63e-18 SMART
IPT 685 769 4.03e-23 SMART
IPT 771 873 8.41e-12 SMART
IPT 878 972 5.36e0 SMART
TyrKc 1059 1318 8.2e-134 SMART
low complexity region 1349 1360 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195617
SMART Domains Protein: ENSMUSP00000142201
Gene: ENSMUSG00000032584

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 57 442 3.5e-63 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: This gene encodes a precursor protein that is proteolytically cleaved to yield an alpha chain and a beta chain which form a membrane-spanning heterodimer. The encoded protein belongs to a family of cell-surface receptor tyrosine kinases involved in signaling from the cell surface to the intracellular environment. The binding of the encoded protein to its ligand, macrophage-stimulating protein, mediates several biological activities including wound healing, tumor immunity, macrophage activation and hematopoiesis as well as cell growth, motility, survival and adhesion. The protein encoded by this gene also functions in early development and the macrophage-mediated inflammatory response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: This locus controls susceptibility to splenomegaly or spleen focus formation induced by inoculation with Friend leukemia virus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik T A 5: 113,723,807 M1L unknown Het
AA792892 A G 5: 94,383,844 K196E probably damaging Het
Abcc9 A T 6: 142,590,370 M1546K probably benign Het
Acbd3 T C 1: 180,726,316 M72T probably benign Het
Adam6a T G 12: 113,546,137 L710R probably benign Het
Aldh4a1 T C 4: 139,638,522 S275P probably benign Het
Ap3d1 A T 10: 80,732,903 L47Q probably damaging Het
Arhgap19 G A 19: 41,774,176 R414C probably damaging Het
Ascc3 T C 10: 50,649,907 S572P probably benign Het
Cdk10 G A 8: 123,228,357 R78H probably benign Het
Celsr2 C T 3: 108,413,531 R655H possibly damaging Het
Cntnap2 T A 6: 47,049,373 H44Q probably benign Het
Cpped1 A T 16: 11,894,929 C32* probably null Het
Ddi1 A G 9: 6,266,249 V40A probably benign Het
Ddx50 T C 10: 62,621,508 T588A probably benign Het
Degs2 A G 12: 108,691,964 I252T possibly damaging Het
Dnah1 C T 14: 31,273,015 V2762I probably benign Het
Dnah5 A G 15: 28,444,167 D4037G probably benign Het
Dnah5 C T 15: 28,444,323 A4089V probably null Het
Dthd1 A T 5: 62,849,738 D594V probably damaging Het
Ehmt1 A T 2: 24,852,769 M466K probably benign Het
Erich2 A T 2: 70,527,529 probably null Het
Fam129a T A 1: 151,696,150 V282D probably damaging Het
Fam221b T C 4: 43,665,519 D313G probably benign Het
Fbxl22 T C 9: 66,514,450 D35G possibly damaging Het
Ggcx A G 6: 72,429,591 E679G probably benign Het
Gm14295 A G 2: 176,809,514 T266A probably benign Het
Hnrnpa1 A G 15: 103,242,102 D160G probably null Het
Hnrnpul1 T C 7: 25,722,822 probably benign Het
Hydin A G 8: 110,533,124 E2576G possibly damaging Het
Ifit2 T A 19: 34,573,508 C149* probably null Het
Il18rap T A 1: 40,524,924 S67R probably benign Het
Kcnk4 T G 19: 6,926,300 S294R probably benign Het
Kif21b A G 1: 136,172,945 H1588R probably damaging Het
Klhl35 A T 7: 99,472,922 S77C probably damaging Het
Lats2 A T 14: 57,697,410 M228K probably damaging Het
Lrfn4 T C 19: 4,612,228 D587G probably benign Het
Lrrd1 C A 5: 3,866,509 T842K probably benign Het
Mafb G A 2: 160,366,205 H158Y probably benign Het
Mapk8ip3 T A 17: 24,904,951 E561D probably damaging Het
Mcemp1 A G 8: 3,667,542 T158A probably damaging Het
Muc16 A G 9: 18,658,778 I815T unknown Het
Ncoa6 T A 2: 155,406,252 I1711L possibly damaging Het
Neo1 G A 9: 58,878,119 T1408M probably damaging Het
Nnt A C 13: 119,339,832 F632C probably damaging Het
Nup210 G A 6: 91,074,348 T351I probably benign Het
Olfr1312 A G 2: 112,042,598 S145P probably damaging Het
Olfr670 A G 7: 104,960,727 S2P probably benign Het
P4ha1 C T 10: 59,355,363 T364I probably damaging Het
Pcdhb11 T A 18: 37,422,199 L194Q probably damaging Het
Rad51ap1 A G 6: 126,924,916 probably null Het
Rbm11 G A 16: 75,600,806 R208K probably benign Het
Rps6ka1 T A 4: 133,860,057 Q535L possibly damaging Het
Slc26a3 A G 12: 31,466,506 D621G probably benign Het
Sox10 T G 15: 79,156,452 E296A probably damaging Het
St3gal4 A C 9: 35,053,142 V188G probably damaging Het
Trim34a A T 7: 104,260,971 I327F probably damaging Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Zc2hc1c A G 12: 85,290,697 E376G probably damaging Het
Zfp423 G A 8: 87,783,282 P77S probably damaging Het
Zfp560 A T 9: 20,348,935 S210R probably benign Het
Other mutations in Mst1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Mst1r APN 9 107913250 splice site probably benign
IGL01327:Mst1r APN 9 107907844 missense probably benign 0.03
IGL01572:Mst1r APN 9 107911592 missense probably damaging 1.00
IGL01968:Mst1r APN 9 107916806 splice site probably null
IGL01983:Mst1r APN 9 107917276 missense probably damaging 0.99
IGL02096:Mst1r APN 9 107917279 missense probably damaging 0.97
IGL02203:Mst1r APN 9 107913149 missense possibly damaging 0.61
IGL02203:Mst1r APN 9 107907869 missense probably damaging 1.00
IGL02332:Mst1r APN 9 107907826 nonsense probably null
IGL02402:Mst1r APN 9 107916827 missense probably damaging 0.99
IGL02404:Mst1r APN 9 107913067 splice site probably benign
IGL02942:Mst1r APN 9 107913153 missense possibly damaging 0.89
IGL02951:Mst1r APN 9 107908204 missense possibly damaging 0.88
IGL02975:Mst1r APN 9 107913180 missense probably benign 0.20
IGL03005:Mst1r APN 9 107914549 nonsense probably null
IGL03304:Mst1r APN 9 107907938 missense probably damaging 1.00
R0386:Mst1r UTSW 9 107916804 splice site probably null
R0833:Mst1r UTSW 9 107913167 missense probably benign
R0833:Mst1r UTSW 9 107914776 missense probably benign 0.00
R1139:Mst1r UTSW 9 107919969 missense possibly damaging 0.93
R1371:Mst1r UTSW 9 107917225 missense probably damaging 1.00
R1477:Mst1r UTSW 9 107908324 missense probably benign
R1479:Mst1r UTSW 9 107913345 splice site probably benign
R1541:Mst1r UTSW 9 107917363 missense probably damaging 0.99
R1698:Mst1r UTSW 9 107919980 missense probably benign 0.06
R1891:Mst1r UTSW 9 107913462 missense probably damaging 1.00
R1971:Mst1r UTSW 9 107913212 missense probably benign 0.06
R1974:Mst1r UTSW 9 107914763 missense probably damaging 1.00
R1974:Mst1r UTSW 9 107915933 critical splice donor site probably null
R2144:Mst1r UTSW 9 107913168 missense probably benign
R2221:Mst1r UTSW 9 107908348 missense probably damaging 1.00
R2356:Mst1r UTSW 9 107917870 missense probably damaging 1.00
R3913:Mst1r UTSW 9 107914746 missense probably benign
R4768:Mst1r UTSW 9 107911650 missense probably damaging 1.00
R4793:Mst1r UTSW 9 107919925 missense probably damaging 0.96
R5141:Mst1r UTSW 9 107912241 missense probably damaging 0.99
R5191:Mst1r UTSW 9 107911551 missense probably damaging 0.98
R5238:Mst1r UTSW 9 107907574 missense probably damaging 1.00
R6024:Mst1r UTSW 9 107908151 missense probably benign 0.00
R6220:Mst1r UTSW 9 107907348 missense probably benign 0.11
R6256:Mst1r UTSW 9 107917266 missense probably damaging 1.00
R6361:Mst1r UTSW 9 107915853 missense probably benign
R6522:Mst1r UTSW 9 107913239 missense probably benign 0.00
R6559:Mst1r UTSW 9 107908271 missense possibly damaging 0.91
R6863:Mst1r UTSW 9 107920026 missense probably benign
R6868:Mst1r UTSW 9 107915933 critical splice donor site probably null
R6873:Mst1r UTSW 9 107911644 missense possibly damaging 0.90
R6978:Mst1r UTSW 9 107912594 missense probably benign 0.23
R7168:Mst1r UTSW 9 107908193 missense probably benign 0.01
R7299:Mst1r UTSW 9 107914790 missense possibly damaging 0.46
R7301:Mst1r UTSW 9 107914790 missense possibly damaging 0.46
R7405:Mst1r UTSW 9 107915122 missense possibly damaging 0.87
R7615:Mst1r UTSW 9 107920012 missense probably benign 0.05
R7684:Mst1r UTSW 9 107911563 missense probably benign 0.01
R7741:Mst1r UTSW 9 107907120 start gained probably benign
R7916:Mst1r UTSW 9 107907578 missense probably damaging 1.00
R7987:Mst1r UTSW 9 107912798 splice site probably null
R8177:Mst1r UTSW 9 107907585 missense probably damaging 1.00
R8494:Mst1r UTSW 9 107914519 missense possibly damaging 0.90
R8692:Mst1r UTSW 9 107914851 missense possibly damaging 0.82
X0026:Mst1r UTSW 9 107913203 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GACACTGTGGTTCTTAAGGCC -3'
(R):5'- ACTTGGGGAGTCTCTATGCTCG -3'

Sequencing Primer
(F):5'- CTTCGAAGGACTTGGATCAGATC -3'
(R):5'- CTCTATGCTCGGATCATGCAGAAAAG -3'
Posted On2021-01-18