Incidental Mutation 'R8558:1700017N19Rik'
ID660869
Institutional Source Beutler Lab
Gene Symbol 1700017N19Rik
Ensembl Gene ENSMUSG00000056912
Gene NameRIKEN cDNA 1700017N19 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R8558 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location100590484-100618401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100594635 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 51 (R51S)
Ref Sequence ENSEMBL: ENSMUSP00000139797 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000041162
Predicted Effect probably benign
Transcript: ENSMUST00000186825
AA Change: R51S

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000187119
Predicted Effect probably benign
Transcript: ENSMUST00000188736
Predicted Effect probably benign
Transcript: ENSMUST00000188930
Predicted Effect probably benign
Transcript: ENSMUST00000190386
Predicted Effect probably benign
Transcript: ENSMUST00000190708
AA Change: R51S

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000191336
Predicted Effect probably benign
Transcript: ENSMUST00000218464
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik G T 17: 48,090,329 E45* probably null Het
4932438A13Rik T A 3: 37,048,601 M1443K Het
Abcb5 T C 12: 118,877,831 T960A probably benign Het
Abcc3 A G 11: 94,351,797 probably null Het
Adamtsl3 A T 7: 82,428,392 D95V possibly damaging Het
Ash1l T A 3: 88,984,406 S1197R probably damaging Het
BC034090 T A 1: 155,221,339 H671L possibly damaging Het
Btnl9 T C 11: 49,180,792 E68G probably benign Het
C1qtnf1 A T 11: 118,448,323 Y273F probably damaging Het
C4b A T 17: 34,736,567 C714S probably damaging Het
Carmil1 G A 13: 24,025,880 T1204I probably benign Het
Ccdc105 T C 10: 78,747,201 K450E probably damaging Het
Cdk12 T C 11: 98,211,089 L591P unknown Het
Ces2f T A 8: 104,953,126 L417* probably null Het
Chl1 T A 6: 103,708,429 S810R probably benign Het
Ckap2 A G 8: 22,168,795 V644A possibly damaging Het
Ctdsp2 T A 10: 126,993,877 V126E probably damaging Het
Dok6 G T 18: 89,473,942 H170Q probably damaging Het
Dynlrb1 T C 2: 155,242,808 probably null Het
Eif5b T C 1: 38,044,714 L757S probably damaging Het
Epas1 A C 17: 86,809,468 T189P possibly damaging Het
Epha10 C A 4: 124,894,984 N283K Het
Epha5 C A 5: 84,059,116 G853C probably damaging Het
Gapvd1 A T 2: 34,704,481 H831Q probably damaging Het
Gcnt3 T A 9: 70,034,714 K191* probably null Het
Gm14226 T A 2: 155,024,989 S289T probably benign Het
Gm4846 T A 1: 166,487,105 D323V probably damaging Het
Golga3 G T 5: 110,208,555 R1036L possibly damaging Het
Gopc T C 10: 52,353,484 Q213R probably damaging Het
Hrh1 G A 6: 114,480,603 V282M probably benign Het
Ighv5-4 T C 12: 113,597,458 Y114C probably damaging Het
Igkv10-94 A T 6: 68,704,652 I68N probably damaging Het
Kcnj3 A G 2: 55,446,863 D247G possibly damaging Het
Lcn6 C A 2: 25,680,706 S102Y probably damaging Het
Matk C A 10: 81,260,931 H232N probably benign Het
Mcm9 C T 10: 53,615,972 V366I probably benign Het
Mgea5 T C 19: 45,758,072 S763G probably benign Het
Nadk A G 4: 155,585,387 I176V probably benign Het
Nlrp12 A G 7: 3,249,481 L20P probably damaging Het
Olfr1118 A T 2: 87,309,239 Q170L probably benign Het
Olfr1245 A G 2: 89,574,985 L247P probably damaging Het
Olfr380 G A 11: 73,453,483 S243F probably damaging Het
Park2 T C 17: 11,237,585 S99P probably benign Het
Pcdhgb6 T A 18: 37,744,184 D648E probably damaging Het
Pkd1l3 A T 8: 109,635,380 N1018I probably damaging Het
Plch2 T C 4: 154,998,934 K516E probably damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Pnma2 C T 14: 66,916,523 A132V probably benign Het
Prune2 A G 19: 17,122,238 E1702G probably damaging Het
Qars T A 9: 108,515,223 H756Q probably benign Het
Rab5a A G 17: 53,483,849 probably benign Het
Rars2 A G 4: 34,657,199 D515G probably damaging Het
Rpe65 T A 3: 159,614,792 C329S probably damaging Het
Rps6ka2 G A 17: 7,255,917 V231M possibly damaging Het
Rsf1 GCG GCGACGGCGCCG 7: 97,579,907 probably benign Het
Scrt1 G T 15: 76,519,643 S49* probably null Het
Sec23b C G 2: 144,586,388 D640E possibly damaging Het
Setdb1 C T 3: 95,354,668 V96M possibly damaging Het
Sik3 C A 9: 46,155,448 A175E probably damaging Het
Smarcad1 A G 6: 65,083,924 K463E probably benign Het
Sobp A C 10: 43,127,892 C154G probably damaging Het
Sox6 A G 7: 115,541,798 S482P probably benign Het
Spen C T 4: 141,470,370 A3396T probably benign Het
Spink11 T A 18: 44,191,681 R75* probably null Het
Sptb T C 12: 76,612,787 H1113R probably benign Het
Sypl2 A T 3: 108,217,688 V119E probably damaging Het
Tbc1d24 T C 17: 24,208,929 S20G unknown Het
Top2a A T 11: 99,021,723 V106D probably damaging Het
Tspyl4 G C 10: 34,298,265 R251P probably damaging Het
Ttc21a T A 9: 119,958,769 L801Q probably damaging Het
Vgll3 A G 16: 65,827,958 E64G probably damaging Het
Vmn2r30 A G 7: 7,312,656 I726T possibly damaging Het
Vmn2r81 T C 10: 79,270,633 S482P possibly damaging Het
Wasf1 T G 10: 40,930,652 M97R possibly damaging Het
Wdr33 T A 18: 31,829,894 M98K probably benign Het
Wdr73 G A 7: 80,898,506 T95I probably damaging Het
Other mutations in 1700017N19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01565:1700017N19Rik APN 10 100603360 missense probably damaging 1.00
IGL02159:1700017N19Rik APN 10 100610665 missense probably damaging 1.00
IGL02556:1700017N19Rik APN 10 100610717 critical splice donor site probably null
IGL02629:1700017N19Rik APN 10 100609144 splice site probably benign
IGL02692:1700017N19Rik APN 10 100603548 missense probably benign 0.05
IGL02962:1700017N19Rik APN 10 100610593 splice site probably null
R0145:1700017N19Rik UTSW 10 100601921 missense probably damaging 0.96
R0402:1700017N19Rik UTSW 10 100609253 missense probably damaging 0.99
R1514:1700017N19Rik UTSW 10 100612867 missense probably damaging 1.00
R1519:1700017N19Rik UTSW 10 100603528 missense probably damaging 0.98
R1680:1700017N19Rik UTSW 10 100603528 missense probably damaging 0.98
R1686:1700017N19Rik UTSW 10 100612860 missense probably damaging 0.97
R3951:1700017N19Rik UTSW 10 100615296 splice site probably benign
R3952:1700017N19Rik UTSW 10 100615296 splice site probably benign
R4423:1700017N19Rik UTSW 10 100605633 missense probably damaging 0.99
R4905:1700017N19Rik UTSW 10 100612818 splice site probably null
R5507:1700017N19Rik UTSW 10 100609233 missense probably benign 0.02
R5898:1700017N19Rik UTSW 10 100612900 missense possibly damaging 0.56
R5898:1700017N19Rik UTSW 10 100615208 missense probably benign 0.20
R5977:1700017N19Rik UTSW 10 100615244 missense probably damaging 0.99
R7034:1700017N19Rik UTSW 10 100609256 critical splice donor site probably null
R7036:1700017N19Rik UTSW 10 100609256 critical splice donor site probably null
R7394:1700017N19Rik UTSW 10 100609176 missense probably benign 0.01
R7412:1700017N19Rik UTSW 10 100612829 nonsense probably null
R7870:1700017N19Rik UTSW 10 100605643 missense probably benign
R7914:1700017N19Rik UTSW 10 100592676 missense probably benign
R8466:1700017N19Rik UTSW 10 100602011 missense probably benign 0.00
Z1088:1700017N19Rik UTSW 10 100605639 missense probably damaging 1.00
Z1176:1700017N19Rik UTSW 10 100612429 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGTGGACTCCTTATTCCTTAATTGG -3'
(R):5'- AGCCTTCATTTCTGACTTAAGGTC -3'

Sequencing Primer
(F):5'- TGGTTAACATTTTGTGATTAAACGC -3'
(R):5'- GACTTAAGGTCATCATGCTTTCTAC -3'
Posted On2021-03-08