Incidental Mutation 'R8721:Arhgap24'
ID662112
Institutional Source Beutler Lab
Gene Symbol Arhgap24
Ensembl Gene ENSMUSG00000057315
Gene NameRho GTPase activating protein 24
Synonyms0610025G21Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8721 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location102481391-102897937 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102875699 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 200 (T200S)
Ref Sequence ENSEMBL: ENSMUSP00000092138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070000] [ENSMUST00000073302] [ENSMUST00000094559] [ENSMUST00000112852] [ENSMUST00000112853] [ENSMUST00000112854]
Predicted Effect probably damaging
Transcript: ENSMUST00000070000
AA Change: T110S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070048
Gene: ENSMUSG00000057315
AA Change: T110S

DomainStartEndE-ValueType
RhoGAP 58 234 7.04e-67 SMART
low complexity region 476 487 N/A INTRINSIC
low complexity region 520 539 N/A INTRINSIC
coiled coil region 558 638 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000073302
AA Change: T107S

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073028
Gene: ENSMUSG00000057315
AA Change: T107S

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000094559
AA Change: T200S

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000092138
Gene: ENSMUSG00000057315
AA Change: T200S

DomainStartEndE-ValueType
PH 18 125 5.35e-23 SMART
RhoGAP 148 324 7.04e-67 SMART
low complexity region 566 577 N/A INTRINSIC
low complexity region 610 629 N/A INTRINSIC
coiled coil region 648 728 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112852
AA Change: T107S

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108473
Gene: ENSMUSG00000057315
AA Change: T107S

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112853
AA Change: T107S

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108474
Gene: ENSMUSG00000057315
AA Change: T107S

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112854
AA Change: T107S

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108475
Gene: ENSMUSG00000057315
AA Change: T107S

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Rho-GTPase activating protein, which is specific for the small GTPase family member Rac. Binding of the encoded protein by filamin A targets it to sites of membrane protrusion, where it antognizes Rac. This results in suppression of lamellae formation and promotion of retraction to regulate cell polarity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,277,606 S1785P unknown Het
Abca9 T C 11: 110,144,289 D684G possibly damaging Het
Abhd16a T C 17: 35,091,595 V94A possibly damaging Het
Acly A T 11: 100,521,980 probably null Het
Adamts1 G T 16: 85,797,887 T621K probably damaging Het
Arhgap31 A G 16: 38,606,696 V598A probably benign Het
Ascc1 T C 10: 60,098,106 F323S possibly damaging Het
Ces2b T A 8: 104,833,895 V114D possibly damaging Het
Cfap73 T C 5: 120,630,024 E223G probably benign Het
Csnk1e T C 15: 79,429,815 N78S possibly damaging Het
Cyp7a1 G T 4: 6,268,273 A484E probably damaging Het
Dnah9 G T 11: 66,095,298 T1170K probably damaging Het
Fam83d G T 2: 158,785,602 V404L probably benign Het
Fbxw28 C T 9: 109,328,314 V289I probably benign Het
Frs2 T G 10: 117,074,030 I476L probably benign Het
Gbp2b A T 3: 142,606,944 I363F possibly damaging Het
Gm8267 A T 14: 44,722,050 F186I possibly damaging Het
Hand1 A G 11: 57,831,779 L3P probably damaging Het
Hmcn2 C T 2: 31,425,177 L3671F probably damaging Het
Hspa12b A G 2: 131,141,002 D260G probably benign Het
Itih2 T C 2: 10,106,808 K440E probably damaging Het
Morn4 A T 19: 42,078,000 N49K possibly damaging Het
Mtmr6 T G 14: 60,289,679 probably null Het
Mylk A T 16: 34,996,806 D1848V probably damaging Het
Myo7b A G 18: 32,007,011 V242A probably damaging Het
Olfr1247 T C 2: 89,609,842 K87E probably benign Het
Olfr27 T G 9: 39,144,090 probably benign Het
Rmdn3 T A 2: 119,139,365 Q405L possibly damaging Het
Robo2 A G 16: 73,906,910 S30P Het
Suclg1 G T 6: 73,269,379 L218F probably damaging Het
Tas2r134 T C 2: 51,627,559 S17P probably damaging Het
Tdrd9 T C 12: 112,036,455 L846P probably damaging Het
Tgfbi A G 13: 56,625,786 N199S probably benign Het
Traj35 C T 14: 54,183,815 T14I Het
Tril A G 6: 53,820,198 V13A probably benign Het
Tshz2 T A 2: 169,885,358 S625T probably benign Het
Ttll12 A G 15: 83,580,583 F464L probably damaging Het
Wdr35 T C 12: 9,025,044 probably null Het
Zfp346 A G 13: 55,113,678 S94G possibly damaging Het
Zfp429 T A 13: 67,390,212 Y371F probably damaging Het
Zscan4-ps2 A T 7: 11,517,595 E186V probably benign Het
Other mutations in Arhgap24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Arhgap24 APN 5 102860399 missense possibly damaging 0.94
IGL01483:Arhgap24 APN 5 102860377 missense possibly damaging 0.91
IGL02641:Arhgap24 APN 5 102892520 missense probably damaging 1.00
IGL03166:Arhgap24 APN 5 102875686 splice site probably benign
bullmarket UTSW 5 102875777 missense probably damaging 0.99
buyers UTSW 5 102897220 missense probably damaging 1.00
wallstreet UTSW 5 102552297 splice site probably null
BB009:Arhgap24 UTSW 5 102845969 intron probably benign
BB019:Arhgap24 UTSW 5 102845969 intron probably benign
R0506:Arhgap24 UTSW 5 102875777 missense probably damaging 0.99
R0606:Arhgap24 UTSW 5 102897220 missense probably damaging 1.00
R1457:Arhgap24 UTSW 5 102664106 missense probably damaging 0.98
R1491:Arhgap24 UTSW 5 102860332 missense possibly damaging 0.47
R1707:Arhgap24 UTSW 5 102892087 missense probably benign 0.40
R2112:Arhgap24 UTSW 5 102892500 missense probably damaging 1.00
R2300:Arhgap24 UTSW 5 102860425 missense probably damaging 1.00
R2516:Arhgap24 UTSW 5 102891910 missense probably benign
R3803:Arhgap24 UTSW 5 102892442 missense probably damaging 0.98
R4257:Arhgap24 UTSW 5 102664117 missense probably benign 0.00
R4761:Arhgap24 UTSW 5 102664214 intron probably benign
R5045:Arhgap24 UTSW 5 102891877 missense possibly damaging 0.79
R5121:Arhgap24 UTSW 5 102841335 missense probably damaging 1.00
R5209:Arhgap24 UTSW 5 102892149 missense probably benign 0.12
R5667:Arhgap24 UTSW 5 102846171 critical splice donor site probably null
R5914:Arhgap24 UTSW 5 102552159 splice site probably null
R6039:Arhgap24 UTSW 5 102880786 missense probably damaging 0.98
R6039:Arhgap24 UTSW 5 102880786 missense probably damaging 0.98
R6158:Arhgap24 UTSW 5 102892912 missense probably benign 0.12
R6410:Arhgap24 UTSW 5 102892151 missense probably benign 0.10
R6450:Arhgap24 UTSW 5 102897124 missense probably benign 0.01
R6520:Arhgap24 UTSW 5 102880793 missense probably benign 0.00
R6666:Arhgap24 UTSW 5 102552297 splice site probably null
R7233:Arhgap24 UTSW 5 102878501 missense probably benign 0.03
R7311:Arhgap24 UTSW 5 102892685 missense probably damaging 1.00
R7460:Arhgap24 UTSW 5 102892346 missense probably benign 0.36
R7483:Arhgap24 UTSW 5 102841308 missense probably benign 0.13
R7515:Arhgap24 UTSW 5 102846016 intron probably benign
R7667:Arhgap24 UTSW 5 102878457 missense probably benign
R7932:Arhgap24 UTSW 5 102845969 intron probably benign
R8227:Arhgap24 UTSW 5 102875781 missense probably benign 0.02
R8289:Arhgap24 UTSW 5 102880826 missense possibly damaging 0.88
R8431:Arhgap24 UTSW 5 102892598 missense possibly damaging 0.49
R8767:Arhgap24 UTSW 5 102891874 missense probably benign
Z1176:Arhgap24 UTSW 5 102875759 missense probably damaging 0.97
Z1176:Arhgap24 UTSW 5 102880807 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAACTGAAGGCTTGGCGTCC -3'
(R):5'- GAAGGGAAGCTTTCAAACTGC -3'

Sequencing Primer
(F):5'- CTGAGTCCTGTGGTAGCATCTAC -3'
(R):5'- GAAGCTTTCAAACTGCAGACAATAAG -3'
Posted On2021-03-08