Incidental Mutation 'R8746:Cadm2'
ID 663574
Institutional Source Beutler Lab
Gene Symbol Cadm2
Ensembl Gene ENSMUSG00000064115
Gene Name cell adhesion molecule 2
Synonyms A830029E02Rik, Necl3, 2900078E11Rik, Igsf4d, SynCAM2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.476) question?
Stock # R8746 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 66655421-67620908 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 66784809 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 203 (R203L)
Ref Sequence ENSEMBL: ENSMUSP00000109931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114292] [ENSMUST00000120594] [ENSMUST00000120898] [ENSMUST00000123266] [ENSMUST00000128168]
AlphaFold Q8BLQ9
PDB Structure Crystal structure of Ig1 domain of mouse SynCAM 2 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000114292
AA Change: R203L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109931
Gene: ENSMUSG00000064115
AA Change: R203L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 38 130 2.19e-9 SMART
Pfam:Ig_3 135 216 1.2e-6 PFAM
Pfam:C2-set_2 135 222 6.4e-17 PFAM
Pfam:Ig_2 135 228 1.8e-6 PFAM
Pfam:I-set 136 229 1.3e-7 PFAM
Pfam:C1-set 142 225 1.5e-9 PFAM
IGc2 248 312 2.56e-10 SMART
4.1m 357 375 5.39e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120594
AA Change: R194L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113500
Gene: ENSMUSG00000064115
AA Change: R194L

DomainStartEndE-ValueType
IG 29 121 2.19e-9 SMART
Pfam:Ig_3 126 207 4.2e-7 PFAM
Pfam:C2-set_2 126 213 1.8e-16 PFAM
Pfam:I-set 127 220 1.5e-7 PFAM
Pfam:C1-set 133 216 7e-10 PFAM
Pfam:ig 133 218 9.5e-9 PFAM
IGc2 239 303 2.56e-10 SMART
low complexity region 319 352 N/A INTRINSIC
4.1m 388 406 5.39e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120898
AA Change: R194L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113178
Gene: ENSMUSG00000064115
AA Change: R194L

DomainStartEndE-ValueType
IG 29 121 2.19e-9 SMART
Pfam:Ig_3 126 207 1.2e-6 PFAM
Pfam:C2-set_2 126 213 6.2e-17 PFAM
Pfam:Ig_2 126 219 1.7e-6 PFAM
Pfam:I-set 127 220 1.3e-7 PFAM
Pfam:C1-set 133 216 1.5e-9 PFAM
IGc2 239 303 2.56e-10 SMART
4.1m 348 366 5.39e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123266
AA Change: R47L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000123192
Gene: ENSMUSG00000064115
AA Change: R47L

DomainStartEndE-ValueType
Blast:IG_like 19 53 1e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000128168
AA Change: R194L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134554
Gene: ENSMUSG00000064115
AA Change: R194L

DomainStartEndE-ValueType
IG 29 121 2.19e-9 SMART
Pfam:Ig_3 126 207 1.4e-6 PFAM
Pfam:C2-set_2 126 213 7.2e-16 PFAM
Pfam:I-set 127 220 5e-7 PFAM
Pfam:C1-set 133 216 2.2e-9 PFAM
Pfam:ig 133 218 3.6e-8 PFAM
IGc2 239 303 2.56e-10 SMART
low complexity region 319 352 N/A INTRINSIC
4.1m 388 406 5.39e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the synaptic cell adhesion molecule 1 (SynCAM) family which belongs to the immunoglobulin (Ig) superfamily. The encoded protein has three Ig-like domains and a cytosolic protein 4.1 binding site near the C-terminus. Proteins belonging to the protein 4.1 family crosslink spectrin and interact with other cytoskeletal proteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice with ubiquitous conditional deletion of the gene do not display any neurological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,303,410 M871K probably benign Het
5530400C23Rik A C 6: 133,294,293 E100A possibly damaging Het
Aatf A T 11: 84,511,512 I116N probably benign Het
Abcb11 G T 2: 69,257,410 probably benign Het
Adarb2 G T 13: 8,752,644 A652S probably benign Het
Adgb C T 10: 10,405,284 probably null Het
Ankrd34a C T 3: 96,597,475 probably benign Het
Ano2 A G 6: 125,863,550 I395V probably benign Het
Ccr2 T C 9: 124,106,411 F243L probably benign Het
Ccr4 A G 9: 114,492,850 V49A probably damaging Het
Corin T C 5: 72,435,352 D234G probably benign Het
Drd5 G T 5: 38,320,090 R142I probably benign Het
Dsg1b A G 18: 20,395,999 D264G probably damaging Het
Ezh2 T C 6: 47,576,600 K61R probably damaging Het
Frmd4b T A 6: 97,292,409 T981S probably benign Het
Gcg T A 2: 62,474,981 K180N probably damaging Het
Gm10840 G A 11: 106,160,916 E23K unknown Het
Gm2696 T G 10: 77,815,203 C174W unknown Het
Grin2b T C 6: 135,922,987 I299V probably benign Het
Hepacam T A 9: 37,381,734 V207E probably damaging Het
Igf1r T A 7: 68,214,997 M1181K probably damaging Het
Lmo2 T C 2: 103,976,039 S96P possibly damaging Het
Marf1 T A 16: 14,117,304 E1533D probably benign Het
Megf9 A G 4: 70,435,274 C432R probably damaging Het
Mpp2 A G 11: 102,063,214 Y236H probably damaging Het
Neb T C 2: 52,282,601 I1565V probably damaging Het
Olfr1001-ps1 T A 2: 85,633,877 Y149* probably null Het
Olfr1392 A G 11: 49,293,166 probably benign Het
Olfr1469 A G 19: 13,410,728 D53G probably benign Het
Olfr203 T A 16: 59,303,610 F152L probably benign Het
Olfr308 C T 7: 86,321,229 C241Y probably damaging Het
Olfr663 A T 7: 104,703,860 I98F probably damaging Het
Olfr826 T C 10: 130,180,217 Y221C probably damaging Het
Patj T A 4: 98,505,830 probably benign Het
Pknox1 A T 17: 31,590,650 Q76L possibly damaging Het
Plekhg1 C A 10: 3,957,777 T953K Het
Plekhn1 C A 4: 156,232,225 R333L probably damaging Het
Plk5 T A 10: 80,358,776 V111D probably benign Het
Polr1b A G 2: 129,112,677 I398M possibly damaging Het
Ranbp3 T C 17: 56,702,826 V137A probably benign Het
Rc3h1 T A 1: 160,930,174 F21I probably damaging Het
Rgs8 T C 1: 153,671,791 S56P probably damaging Het
Rhpn1 G A 15: 75,713,576 V593M probably damaging Het
Sdad1 A G 5: 92,289,925 S589P probably benign Het
Skp1a A G 11: 52,246,016 K163R probably damaging Het
Slf2 A G 19: 44,973,624 Y1080C probably damaging Het
Tcf4 C T 18: 69,521,501 probably benign Het
Tmem144 C T 3: 79,825,348 V208M probably damaging Het
Tmem2 G A 19: 21,826,101 G833R probably damaging Het
Tomm34 A T 2: 164,060,964 L142Q probably benign Het
Unc13b T A 4: 43,176,120 V2316D unknown Het
Yme1l1 T A 2: 23,162,531 S66T probably benign Het
Zfc3h1 T C 10: 115,407,980 S739P probably damaging Het
Zscan25 T A 5: 145,287,347 V209E possibly damaging Het
Other mutations in Cadm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Cadm2 APN 16 66882751 missense probably damaging 1.00
IGL01137:Cadm2 APN 16 66815350 missense probably damaging 1.00
IGL01340:Cadm2 APN 16 66784785 missense possibly damaging 0.62
IGL01406:Cadm2 APN 16 66815304 splice site probably null
IGL02029:Cadm2 APN 16 66747296 missense probably damaging 1.00
IGL02541:Cadm2 APN 16 66882882 missense possibly damaging 0.73
IGL02541:Cadm2 APN 16 66882883 critical splice acceptor site probably null
IGL02952:Cadm2 APN 16 66664452 missense probably damaging 0.99
vitro UTSW 16 66882832 nonsense probably null
R0050:Cadm2 UTSW 16 66953266 splice site probably benign
R0050:Cadm2 UTSW 16 66953266 splice site probably benign
R0399:Cadm2 UTSW 16 66747339 nonsense probably null
R0883:Cadm2 UTSW 16 66882814 missense probably damaging 1.00
R1035:Cadm2 UTSW 16 66815347 missense probably damaging 1.00
R1539:Cadm2 UTSW 16 66784840 missense probably damaging 1.00
R1889:Cadm2 UTSW 16 66882795 missense probably damaging 1.00
R1898:Cadm2 UTSW 16 66815383 missense probably damaging 1.00
R1918:Cadm2 UTSW 16 66747384 splice site probably benign
R2108:Cadm2 UTSW 16 66731471 missense probably benign 0.43
R2570:Cadm2 UTSW 16 66815383 missense probably damaging 1.00
R3878:Cadm2 UTSW 16 66815441 missense probably damaging 1.00
R4093:Cadm2 UTSW 16 66784788 missense possibly damaging 0.94
R4094:Cadm2 UTSW 16 66882797 missense probably damaging 1.00
R5421:Cadm2 UTSW 16 66771627 nonsense probably null
R5555:Cadm2 UTSW 16 66784815 missense probably damaging 1.00
R6173:Cadm2 UTSW 16 66882841 missense probably benign 0.04
R6188:Cadm2 UTSW 16 66815307 critical splice donor site probably null
R6224:Cadm2 UTSW 16 66664395 missense probably damaging 1.00
R6492:Cadm2 UTSW 16 66784828 missense probably damaging 0.98
R6957:Cadm2 UTSW 16 66812838 missense probably benign 0.02
R7051:Cadm2 UTSW 16 66882879 missense possibly damaging 0.86
R7183:Cadm2 UTSW 16 66882832 nonsense probably null
R7322:Cadm2 UTSW 16 66882846 missense probably damaging 1.00
R7792:Cadm2 UTSW 16 66771637 missense probably benign 0.01
R7882:Cadm2 UTSW 16 66731471 missense probably benign 0.43
R8101:Cadm2 UTSW 16 66812842 missense possibly damaging 0.75
R8166:Cadm2 UTSW 16 66953309 missense probably benign 0.01
R8325:Cadm2 UTSW 16 66815450 missense possibly damaging 0.95
R8496:Cadm2 UTSW 16 66664423 missense probably damaging 1.00
R9396:Cadm2 UTSW 16 66747216 missense probably damaging 0.99
X0026:Cadm2 UTSW 16 66663152 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTAAAGATGGTAAGTTTTGGGCAC -3'
(R):5'- ACCAGTAAATTCAGAGATTGGCTC -3'

Sequencing Primer
(F):5'- GCACATTTGCTGAAACTTTATGTC -3'
(R):5'- TGGCTCTTTAAAAACTGACACCAG -3'
Posted On 2021-03-08