Incidental Mutation 'R8746:Grin2b'
ID663551
Institutional Source Beutler Lab
Gene Symbol Grin2b
Ensembl Gene ENSMUSG00000030209
Gene Nameglutamate receptor, ionotropic, NMDA2B (epsilon 2)
SynonymsGluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8746 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location135713233-136173511 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135922987 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 299 (I299V)
Ref Sequence ENSEMBL: ENSMUSP00000142696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905] [ENSMUST00000152012]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053880
AA Change: I299V

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: I299V

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 106 306 8.6e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 4.8e-270 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111905
AA Change: I299V

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: I299V

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 56 307 4.2e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 2.1e-245 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152012
AA Change: I299V

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000142696
Gene: ENSMUSG00000030209
AA Change: I299V

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 66 312 1.6e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,303,410 M871K probably benign Het
5530400C23Rik A C 6: 133,294,293 E100A possibly damaging Het
Aatf A T 11: 84,511,512 I116N probably benign Het
Abcb11 G T 2: 69,257,410 probably benign Het
Adarb2 G T 13: 8,752,644 A652S probably benign Het
Adgb C T 10: 10,405,284 probably null Het
Ankrd34a C T 3: 96,597,475 probably benign Het
Ano2 A G 6: 125,863,550 I395V probably benign Het
Cadm2 C A 16: 66,784,809 R203L probably damaging Het
Ccr2 T C 9: 124,106,411 F243L probably benign Het
Ccr4 A G 9: 114,492,850 V49A probably damaging Het
Corin T C 5: 72,435,352 D234G probably benign Het
Drd5 G T 5: 38,320,090 R142I probably benign Het
Dsg1b A G 18: 20,395,999 D264G probably damaging Het
Ezh2 T C 6: 47,576,600 K61R probably damaging Het
Frmd4b T A 6: 97,292,409 T981S probably benign Het
Gcg T A 2: 62,474,981 K180N probably damaging Het
Gm10840 G A 11: 106,160,916 E23K unknown Het
Gm2696 T G 10: 77,815,203 C174W unknown Het
Hepacam T A 9: 37,381,734 V207E probably damaging Het
Igf1r T A 7: 68,214,997 M1181K probably damaging Het
Lmo2 T C 2: 103,976,039 S96P possibly damaging Het
Marf1 T A 16: 14,117,304 E1533D probably benign Het
Megf9 A G 4: 70,435,274 C432R probably damaging Het
Mpp2 A G 11: 102,063,214 Y236H probably damaging Het
Neb T C 2: 52,282,601 I1565V probably damaging Het
Olfr1001-ps1 T A 2: 85,633,877 Y149* probably null Het
Olfr1392 A G 11: 49,293,166 probably benign Het
Olfr1469 A G 19: 13,410,728 D53G probably benign Het
Olfr203 T A 16: 59,303,610 F152L probably benign Het
Olfr308 C T 7: 86,321,229 C241Y probably damaging Het
Olfr663 A T 7: 104,703,860 I98F probably damaging Het
Olfr826 T C 10: 130,180,217 Y221C probably damaging Het
Patj T A 4: 98,505,830 probably benign Het
Pknox1 A T 17: 31,590,650 Q76L possibly damaging Het
Plekhg1 C A 10: 3,957,777 T953K Het
Plekhn1 C A 4: 156,232,225 R333L probably damaging Het
Plk5 T A 10: 80,358,776 V111D probably benign Het
Polr1b A G 2: 129,112,677 I398M possibly damaging Het
Ranbp3 T C 17: 56,702,826 V137A probably benign Het
Rc3h1 T A 1: 160,930,174 F21I probably damaging Het
Rgs8 T C 1: 153,671,791 S56P probably damaging Het
Rhpn1 G A 15: 75,713,576 V593M probably damaging Het
Sdad1 A G 5: 92,289,925 S589P probably benign Het
Skp1a A G 11: 52,246,016 K163R probably damaging Het
Slf2 A G 19: 44,973,624 Y1080C probably damaging Het
Tcf4 C T 18: 69,521,501 probably benign Het
Tmem144 C T 3: 79,825,348 V208M probably damaging Het
Tmem2 G A 19: 21,826,101 G833R probably damaging Het
Tomm34 A T 2: 164,060,964 L142Q probably benign Het
Unc13b T A 4: 43,176,120 V2316D unknown Het
Yme1l1 T A 2: 23,162,531 S66T probably benign Het
Zfc3h1 T C 10: 115,407,980 S739P probably damaging Het
Zscan25 T A 5: 145,287,347 V209E possibly damaging Het
Other mutations in Grin2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Grin2b APN 6 135736331 missense possibly damaging 0.55
IGL00835:Grin2b APN 6 135733570 missense probably damaging 1.00
IGL01401:Grin2b APN 6 135736363 missense probably damaging 1.00
IGL01523:Grin2b APN 6 136044265 missense probably null 0.99
IGL01719:Grin2b APN 6 135733381 missense probably damaging 0.97
IGL01907:Grin2b APN 6 135733740 missense probably damaging 1.00
IGL01996:Grin2b APN 6 135732586 missense probably damaging 1.00
IGL02309:Grin2b APN 6 135736472 missense probably damaging 1.00
IGL02312:Grin2b APN 6 135739090 missense probably damaging 1.00
IGL02409:Grin2b APN 6 136043908 missense possibly damaging 0.89
IGL02527:Grin2b APN 6 135923391 missense probably damaging 1.00
IGL02535:Grin2b APN 6 135779369 missense possibly damaging 0.70
IGL02570:Grin2b APN 6 135922998 missense probably damaging 1.00
IGL02702:Grin2b APN 6 135739132 missense probably damaging 0.99
IGL03001:Grin2b APN 6 135739115 missense probably damaging 1.00
IGL03274:Grin2b APN 6 135780255 missense possibly damaging 0.90
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0164:Grin2b UTSW 6 135778648 splice site probably benign
R0194:Grin2b UTSW 6 135779305 missense probably damaging 1.00
R0594:Grin2b UTSW 6 135733929 missense probably damaging 1.00
R1434:Grin2b UTSW 6 135843195 missense probably benign 0.04
R1928:Grin2b UTSW 6 136044046 missense probably damaging 1.00
R1942:Grin2b UTSW 6 135732732 missense possibly damaging 0.93
R1996:Grin2b UTSW 6 136044211 missense possibly damaging 0.52
R2002:Grin2b UTSW 6 135733245 missense probably damaging 1.00
R2020:Grin2b UTSW 6 135733896 missense probably benign 0.12
R2103:Grin2b UTSW 6 135780140 missense probably benign 0.02
R2127:Grin2b UTSW 6 135778700 missense probably benign 0.03
R2495:Grin2b UTSW 6 135733182 missense probably damaging 1.00
R2656:Grin2b UTSW 6 135733429 missense probably damaging 1.00
R2847:Grin2b UTSW 6 135740953 missense probably damaging 1.00
R2866:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R3196:Grin2b UTSW 6 135732455 small deletion probably benign
R3418:Grin2b UTSW 6 135843110 missense probably benign 0.02
R3808:Grin2b UTSW 6 135923271 missense probably damaging 0.99
R4028:Grin2b UTSW 6 135736435 missense probably damaging 1.00
R4602:Grin2b UTSW 6 135778741 missense probably damaging 1.00
R4624:Grin2b UTSW 6 135733825 missense probably damaging 0.99
R4677:Grin2b UTSW 6 135774872 missense probably benign 0.13
R4744:Grin2b UTSW 6 135778699 missense probably damaging 1.00
R5020:Grin2b UTSW 6 135733407 missense probably benign 0.01
R5051:Grin2b UTSW 6 135779395 missense possibly damaging 0.84
R5105:Grin2b UTSW 6 135732441 missense probably benign 0.03
R5125:Grin2b UTSW 6 135923299 missense possibly damaging 0.89
R5146:Grin2b UTSW 6 135779342 missense probably damaging 1.00
R5318:Grin2b UTSW 6 135733918 missense probably damaging 0.99
R5349:Grin2b UTSW 6 136044283 missense possibly damaging 0.93
R5426:Grin2b UTSW 6 135732368 missense probably damaging 1.00
R5438:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5439:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5440:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5530:Grin2b UTSW 6 135733723 missense probably benign 0.00
R5603:Grin2b UTSW 6 135923397 missense probably damaging 1.00
R5657:Grin2b UTSW 6 135733087 missense possibly damaging 0.48
R5788:Grin2b UTSW 6 135740964 missense probably benign 0.24
R5941:Grin2b UTSW 6 135736373 missense probably damaging 0.99
R6057:Grin2b UTSW 6 135733944 missense possibly damaging 0.84
R6137:Grin2b UTSW 6 135923458 missense possibly damaging 0.89
R6216:Grin2b UTSW 6 135772399 missense probably damaging 1.00
R6309:Grin2b UTSW 6 135733027 missense probably benign 0.00
R6316:Grin2b UTSW 6 135780279 missense probably benign 0.00
R6419:Grin2b UTSW 6 135740967 missense probably damaging 1.00
R6551:Grin2b UTSW 6 135733344 missense probably damaging 1.00
R6612:Grin2b UTSW 6 135740998 missense probably damaging 1.00
R6616:Grin2b UTSW 6 135732551 missense probably benign
R6647:Grin2b UTSW 6 135733110 missense probably damaging 1.00
R6806:Grin2b UTSW 6 135774828 missense possibly damaging 0.84
R6976:Grin2b UTSW 6 135780200 missense probably benign
R7033:Grin2b UTSW 6 135923038 missense probably damaging 1.00
R7058:Grin2b UTSW 6 135780306 missense probably damaging 0.97
R7144:Grin2b UTSW 6 135733476 missense possibly damaging 0.50
R7190:Grin2b UTSW 6 135732948 missense possibly damaging 0.46
R7238:Grin2b UTSW 6 135780251 missense probably damaging 0.97
R7453:Grin2b UTSW 6 135740949 missense possibly damaging 0.56
R7553:Grin2b UTSW 6 135772396 missense possibly damaging 0.88
R7585:Grin2b UTSW 6 135779303 missense probably damaging 0.99
R7615:Grin2b UTSW 6 135923364 missense probably damaging 1.00
R7632:Grin2b UTSW 6 135732555 missense probably benign 0.02
R7779:Grin2b UTSW 6 135778794 nonsense probably null
R8058:Grin2b UTSW 6 135733227 missense probably damaging 1.00
R8084:Grin2b UTSW 6 135733488 missense probably benign 0.03
R8145:Grin2b UTSW 6 135732499 missense probably benign 0.01
R8308:Grin2b UTSW 6 135923076 missense probably damaging 0.99
R8357:Grin2b UTSW 6 135732199 missense probably benign 0.00
R8379:Grin2b UTSW 6 135922969 missense probably damaging 1.00
R8429:Grin2b UTSW 6 135733916 missense probably damaging 1.00
R8457:Grin2b UTSW 6 135732199 missense probably benign 0.00
R8925:Grin2b UTSW 6 135772341 missense probably damaging 0.97
R8927:Grin2b UTSW 6 135772341 missense probably damaging 0.97
R8963:Grin2b UTSW 6 136044009 missense probably damaging 1.00
R9075:Grin2b UTSW 6 135732511 frame shift probably null
R9076:Grin2b UTSW 6 135732511 frame shift probably null
RF001:Grin2b UTSW 6 136044240 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGCTGCCATTCTGAACGAC -3'
(R):5'- AAGTAGCTAACTCAGTTGGGCTG -3'

Sequencing Primer
(F):5'- GAACGACCAATCCCTGCTCTTG -3'
(R):5'- TGACTGGCTACGGCTACACATG -3'
Posted On2021-03-08