Incidental Mutation 'R1035:Cadm2'
ID95572
Institutional Source Beutler Lab
Gene Symbol Cadm2
Ensembl Gene ENSMUSG00000064115
Gene Namecell adhesion molecule 2
SynonymsA830029E02Rik, Necl3, 2900078E11Rik, Igsf4d, SynCAM2
MMRRC Submission 039134-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.491) question?
Stock #R1035 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location66655421-67620908 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66815347 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 109 (M109K)
Ref Sequence ENSEMBL: ENSMUSP00000134554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114292] [ENSMUST00000120594] [ENSMUST00000120898] [ENSMUST00000123266] [ENSMUST00000128168]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114292
AA Change: M118K

PolyPhen 2 Score 0.618 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109931
Gene: ENSMUSG00000064115
AA Change: M118K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 38 130 2.19e-9 SMART
Pfam:Ig_3 135 216 1.2e-6 PFAM
Pfam:C2-set_2 135 222 6.4e-17 PFAM
Pfam:Ig_2 135 228 1.8e-6 PFAM
Pfam:I-set 136 229 1.3e-7 PFAM
Pfam:C1-set 142 225 1.5e-9 PFAM
IGc2 248 312 2.56e-10 SMART
4.1m 357 375 5.39e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120594
AA Change: M109K

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113500
Gene: ENSMUSG00000064115
AA Change: M109K

DomainStartEndE-ValueType
IG 29 121 2.19e-9 SMART
Pfam:Ig_3 126 207 4.2e-7 PFAM
Pfam:C2-set_2 126 213 1.8e-16 PFAM
Pfam:I-set 127 220 1.5e-7 PFAM
Pfam:C1-set 133 216 7e-10 PFAM
Pfam:ig 133 218 9.5e-9 PFAM
IGc2 239 303 2.56e-10 SMART
low complexity region 319 352 N/A INTRINSIC
4.1m 388 406 5.39e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120898
AA Change: M109K

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113178
Gene: ENSMUSG00000064115
AA Change: M109K

DomainStartEndE-ValueType
IG 29 121 2.19e-9 SMART
Pfam:Ig_3 126 207 1.2e-6 PFAM
Pfam:C2-set_2 126 213 6.2e-17 PFAM
Pfam:Ig_2 126 219 1.7e-6 PFAM
Pfam:I-set 127 220 1.3e-7 PFAM
Pfam:C1-set 133 216 1.5e-9 PFAM
IGc2 239 303 2.56e-10 SMART
4.1m 348 366 5.39e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123266
SMART Domains Protein: ENSMUSP00000123192
Gene: ENSMUSG00000064115

DomainStartEndE-ValueType
Blast:IG_like 19 53 1e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000128168
AA Change: M109K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134554
Gene: ENSMUSG00000064115
AA Change: M109K

DomainStartEndE-ValueType
IG 29 121 2.19e-9 SMART
Pfam:Ig_3 126 207 1.4e-6 PFAM
Pfam:C2-set_2 126 213 7.2e-16 PFAM
Pfam:I-set 127 220 5e-7 PFAM
Pfam:C1-set 133 216 2.2e-9 PFAM
Pfam:ig 133 218 3.6e-8 PFAM
IGc2 239 303 2.56e-10 SMART
low complexity region 319 352 N/A INTRINSIC
4.1m 388 406 5.39e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141282
Meta Mutation Damage Score 0.1523 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.4%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the synaptic cell adhesion molecule 1 (SynCAM) family which belongs to the immunoglobulin (Ig) superfamily. The encoded protein has three Ig-like domains and a cytosolic protein 4.1 binding site near the C-terminus. Proteins belonging to the protein 4.1 family crosslink spectrin and interact with other cytoskeletal proteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice with ubiquitous conditional deletion of the gene do not display any neurological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Ap3b2 A T 7: 81,463,911 L850Q unknown Het
Asxl3 T C 18: 22,525,049 S2039P probably damaging Het
Caskin1 A G 17: 24,505,037 N933S probably damaging Het
Cbln4 T C 2: 172,042,069 N77S possibly damaging Het
Chek1 A G 9: 36,716,473 I256T probably damaging Het
Col5a3 A T 9: 20,793,499 probably benign Het
Cyp2b10 C T 7: 25,917,048 S360L probably benign Het
Dctn1 T C 6: 83,190,220 S222P probably damaging Het
Dnah7b A G 1: 46,124,448 I471V probably benign Het
Ear2 A T 14: 44,102,887 M1L possibly damaging Het
Entpd6 T A 2: 150,764,192 probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam98b C T 2: 117,270,639 R311W possibly damaging Het
Ggt7 A T 2: 155,506,427 C102S probably damaging Het
Myo15 T C 11: 60,510,558 probably benign Het
Nlrp9c C T 7: 26,371,277 probably benign Het
Nrxn1 A T 17: 90,163,874 N1234K probably damaging Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Pcsk1 T C 13: 75,132,119 S688P probably benign Het
Polr1a T C 6: 71,967,916 F1319L probably benign Het
Ppig T C 2: 69,749,459 Y446H unknown Het
Stk17b T C 1: 53,762,599 T88A probably benign Het
Tas2r143 A T 6: 42,400,265 I10F probably benign Het
Theg G A 10: 79,583,850 T182M probably damaging Het
Tmprss12 G A 15: 100,285,200 R141Q probably benign Het
Trpa1 A G 1: 14,891,303 probably null Het
Txndc16 A G 14: 45,172,563 S187P possibly damaging Het
Vmn2r98 T C 17: 19,080,749 I671T possibly damaging Het
Zfp78 G T 7: 6,378,661 V237F probably damaging Het
Other mutations in Cadm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Cadm2 APN 16 66882751 missense probably damaging 1.00
IGL01137:Cadm2 APN 16 66815350 missense probably damaging 1.00
IGL01340:Cadm2 APN 16 66784785 missense possibly damaging 0.62
IGL01406:Cadm2 APN 16 66815304 splice site probably null
IGL02029:Cadm2 APN 16 66747296 missense probably damaging 1.00
IGL02541:Cadm2 APN 16 66882882 missense possibly damaging 0.73
IGL02541:Cadm2 APN 16 66882883 critical splice acceptor site probably null
IGL02952:Cadm2 APN 16 66664452 missense probably damaging 0.99
R0050:Cadm2 UTSW 16 66953266 splice site probably benign
R0050:Cadm2 UTSW 16 66953266 splice site probably benign
R0399:Cadm2 UTSW 16 66747339 nonsense probably null
R0883:Cadm2 UTSW 16 66882814 missense probably damaging 1.00
R1539:Cadm2 UTSW 16 66784840 missense probably damaging 1.00
R1889:Cadm2 UTSW 16 66882795 missense probably damaging 1.00
R1898:Cadm2 UTSW 16 66815383 missense probably damaging 1.00
R1918:Cadm2 UTSW 16 66747384 splice site probably benign
R2108:Cadm2 UTSW 16 66731471 missense probably benign 0.43
R2570:Cadm2 UTSW 16 66815383 missense probably damaging 1.00
R3878:Cadm2 UTSW 16 66815441 missense probably damaging 1.00
R4093:Cadm2 UTSW 16 66784788 missense possibly damaging 0.94
R4094:Cadm2 UTSW 16 66882797 missense probably damaging 1.00
R5421:Cadm2 UTSW 16 66771627 nonsense probably null
R5555:Cadm2 UTSW 16 66784815 missense probably damaging 1.00
R6173:Cadm2 UTSW 16 66882841 missense probably benign 0.04
R6188:Cadm2 UTSW 16 66815307 critical splice donor site probably null
R6224:Cadm2 UTSW 16 66664395 missense probably damaging 1.00
R6492:Cadm2 UTSW 16 66784828 missense probably damaging 0.98
R6957:Cadm2 UTSW 16 66812838 missense probably benign 0.02
R7051:Cadm2 UTSW 16 66882879 missense possibly damaging 0.86
R7183:Cadm2 UTSW 16 66882832 nonsense probably null
R7322:Cadm2 UTSW 16 66882846 missense probably damaging 1.00
R7792:Cadm2 UTSW 16 66771637 missense probably benign 0.01
R7882:Cadm2 UTSW 16 66731471 missense probably benign 0.43
R8101:Cadm2 UTSW 16 66812842 missense possibly damaging 0.75
R8166:Cadm2 UTSW 16 66953309 missense probably benign 0.01
R8325:Cadm2 UTSW 16 66815450 missense possibly damaging 0.95
X0026:Cadm2 UTSW 16 66663152 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACACAGTATAGCATCATGCTTTCTGCC -3'
(R):5'- TGCAAGATTTCTAGCAGTCTCAGTTCC -3'

Sequencing Primer
(F):5'- GCAACTAAGTGATTCCTAAAGGTG -3'
(R):5'- TCTAGCAGTCTCAGTTCCACAAATG -3'
Posted On2014-01-05