Incidental Mutation 'R9032:Ankib1'
ID 687127
Institutional Source Beutler Lab
Gene Symbol Ankib1
Ensembl Gene ENSMUSG00000040351
Gene Name ankyrin repeat and IBR domain containing 1
Synonyms 2310061P20Rik, 4631416I11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9032 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 3690000-3802925 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 3769641 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 93 (I93V)
Ref Sequence ENSEMBL: ENSMUSP00000040946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043551] [ENSMUST00000200335]
AlphaFold Q6ZPS6
Predicted Effect probably benign
Transcript: ENSMUST00000043551
AA Change: I93V

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000040946
Gene: ENSMUSG00000040351
AA Change: I93V

DomainStartEndE-ValueType
ANK 45 75 7.08e-1 SMART
ANK 145 174 2.32e-5 SMART
low complexity region 209 219 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
RING 334 382 9.73e-2 SMART
IBR 403 479 8.72e-12 SMART
IBR 502 566 2.59e-5 SMART
RING 520 644 2.36e0 SMART
low complexity region 764 773 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
UIM 846 865 3.62e-1 SMART
low complexity region 905 917 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200335
AA Change: I93V

PolyPhen 2 Score 0.182 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000142687
Gene: ENSMUSG00000040351
AA Change: I93V

DomainStartEndE-ValueType
ANK 45 75 4.5e-3 SMART
ANK 145 174 1.4e-7 SMART
low complexity region 209 219 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
RING 334 382 4.6e-4 SMART
IBR 403 479 2.9e-14 SMART
IBR 502 566 8.3e-8 SMART
RING 520 644 1.1e-2 SMART
low complexity region 768 779 N/A INTRINSIC
Meta Mutation Damage Score 0.0866 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik C T 13: 63,296,867 R752* probably null Het
5031439G07Rik C T 15: 84,960,581 M78I probably benign Het
Abca8b C T 11: 109,957,247 V803M probably benign Het
Acap1 T C 11: 69,881,665 E728G probably damaging Het
Afg1l G A 10: 42,318,641 T385M probably damaging Het
Apoa4 T A 9: 46,242,977 L292Q probably damaging Het
Arhgap29 T A 3: 122,014,600 D1142E probably benign Het
Asb5 A T 8: 54,585,894 D265V probably benign Het
Ash1l C T 3: 88,981,987 A391V probably benign Het
Ash1l T C 3: 88,984,222 V1136A probably benign Het
Cacna1c G T 6: 118,638,505 Y1308* probably null Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dmtn A G 14: 70,616,094 S92P probably damaging Het
Edc4 T C 8: 105,887,007 F353S probably damaging Het
Emc1 T C 4: 139,367,163 Y676H possibly damaging Het
Epb41l4b A T 4: 57,041,064 probably null Het
Fat1 A T 8: 45,039,857 N3872I probably benign Het
Fer T A 17: 63,921,772 M214K probably damaging Het
Fgf17 A G 14: 70,636,996 F129L probably damaging Het
Fnbp1 T C 2: 31,083,005 D161G probably damaging Het
Frmd4b A C 6: 97,292,373 S993A probably benign Het
Gm11397 T C 13: 33,397,798 Y113H probably damaging Het
Hsh2d T C 8: 72,200,541 S256P probably benign Het
Il31ra T C 13: 112,524,094 S654G Het
Lmnb2 T C 10: 80,904,257 D442G probably benign Het
Med19 A G 2: 84,685,316 M115V probably damaging Het
Mkl2 A C 16: 13,412,228 T926P probably damaging Het
Mroh5 T C 15: 73,783,453 Y641C probably benign Het
Mrpl18 A T 17: 12,915,695 V61E probably damaging Het
Mtap AC A 4: 89,172,278 probably null Het
Muc2 T A 7: 141,700,489 C154S probably damaging Het
Mypn T G 10: 63,148,115 probably null Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nes T G 3: 87,979,762 V1776G possibly damaging Het
Nxn A G 11: 76,278,557 I132T probably damaging Het
Oxr1 G A 15: 41,854,921 V798I probably benign Het
Papss1 C A 3: 131,619,056 H425N probably damaging Het
Pde4dip T C 3: 97,694,069 N2344S probably benign Het
Pfas C T 11: 68,988,595 G263S Het
Pknox1 C T 17: 31,603,255 T332M possibly damaging Het
Plch2 T C 4: 155,000,519 D321G probably damaging Het
Pnma1 T C 12: 84,147,032 N299S probably benign Het
Psg23 T G 7: 18,614,735 N49T possibly damaging Het
Qrfpr A G 3: 36,221,950 F97S probably damaging Het
Rbl1 A G 2: 157,193,153 F336L probably benign Het
Rpap1 G A 2: 119,778,295 P143S probably benign Het
Rsph6a A T 7: 19,065,325 N294Y probably damaging Het
Sesn1 C T 10: 41,810,839 probably benign Het
Sh3d19 T C 3: 86,126,685 Y782H probably damaging Het
Siglecg T C 7: 43,411,625 V374A probably benign Het
Slc35d2 A G 13: 64,108,413 F156S probably damaging Het
Slc6a11 A T 6: 114,225,847 I301F probably damaging Het
Slx4ip A G 2: 137,068,320 K412E possibly damaging Het
Tas2r115 A T 6: 132,737,364 V208E probably benign Het
Tmem132a G T 19: 10,866,471 Q174K probably damaging Het
Tmem136 C T 9: 43,111,369 R230Q probably benign Het
Tmtc1 A T 6: 148,336,251 Y338* probably null Het
Vav3 C T 3: 109,506,406 A220V probably benign Het
Wt1 C A 2: 105,126,815 Q7K probably benign Het
Zbtb4 T A 11: 69,781,824 F204L probably benign Het
Zfp51 T A 17: 21,464,398 L425H probably damaging Het
Other mutations in Ankib1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Ankib1 APN 5 3727573 missense probably benign 0.20
IGL01329:Ankib1 APN 5 3734194 splice site probably benign
IGL01372:Ankib1 APN 5 3772594 missense probably damaging 1.00
IGL01593:Ankib1 APN 5 3732590 missense probably benign 0.00
IGL01613:Ankib1 APN 5 3713146 nonsense probably null
IGL01728:Ankib1 APN 5 3701992 splice site probably benign
IGL01782:Ankib1 APN 5 3727607 missense probably damaging 1.00
IGL01878:Ankib1 APN 5 3734152 missense possibly damaging 0.69
IGL02730:Ankib1 APN 5 3702995 missense probably damaging 1.00
IGL02742:Ankib1 APN 5 3693479 missense probably benign 0.04
IGL02873:Ankib1 APN 5 3772619 missense probably damaging 1.00
R0033:Ankib1 UTSW 5 3769588 missense possibly damaging 0.52
R0242:Ankib1 UTSW 5 3700344 splice site probably benign
R0564:Ankib1 UTSW 5 3729655 missense probably damaging 0.99
R0632:Ankib1 UTSW 5 3772529 missense probably benign 0.02
R0732:Ankib1 UTSW 5 3713163 missense possibly damaging 0.89
R1678:Ankib1 UTSW 5 3706301 missense probably damaging 0.99
R1816:Ankib1 UTSW 5 3734028 missense probably benign 0.05
R2165:Ankib1 UTSW 5 3713210 missense possibly damaging 0.69
R3434:Ankib1 UTSW 5 3692760 missense probably damaging 1.00
R3749:Ankib1 UTSW 5 3734097 missense probably damaging 0.98
R4745:Ankib1 UTSW 5 3732566 missense probably damaging 1.00
R4827:Ankib1 UTSW 5 3701907 missense probably damaging 1.00
R4983:Ankib1 UTSW 5 3769652 missense probably benign 0.09
R4989:Ankib1 UTSW 5 3713217 missense probably damaging 0.99
R5022:Ankib1 UTSW 5 3734011 missense possibly damaging 0.96
R5057:Ankib1 UTSW 5 3734011 missense possibly damaging 0.96
R5510:Ankib1 UTSW 5 3729693 missense probably benign 0.02
R5606:Ankib1 UTSW 5 3701907 missense probably damaging 1.00
R5910:Ankib1 UTSW 5 3693217 missense probably benign
R5929:Ankib1 UTSW 5 3769633 missense possibly damaging 0.86
R5986:Ankib1 UTSW 5 3747071 missense probably damaging 1.00
R6281:Ankib1 UTSW 5 3701965 missense possibly damaging 0.70
R6336:Ankib1 UTSW 5 3700377 nonsense probably null
R6377:Ankib1 UTSW 5 3693855 missense possibly damaging 0.78
R7001:Ankib1 UTSW 5 3694781 missense probably benign
R7264:Ankib1 UTSW 5 3755739 missense probably damaging 1.00
R7380:Ankib1 UTSW 5 3722576 missense probably benign 0.03
R7402:Ankib1 UTSW 5 3769586 missense probably benign 0.01
R7491:Ankib1 UTSW 5 3701911 missense probably damaging 1.00
R7525:Ankib1 UTSW 5 3755734 missense possibly damaging 0.95
R7562:Ankib1 UTSW 5 3747021 missense probably null 1.00
R8116:Ankib1 UTSW 5 3702995 missense probably damaging 1.00
R8347:Ankib1 UTSW 5 3747065 missense probably damaging 1.00
R8712:Ankib1 UTSW 5 3772643 missense probably benign 0.03
R8750:Ankib1 UTSW 5 3702890 critical splice donor site probably null
R8854:Ankib1 UTSW 5 3727489 missense probably null 0.97
R9180:Ankib1 UTSW 5 3706276 missense probably damaging 1.00
R9325:Ankib1 UTSW 5 3772523 missense possibly damaging 0.81
R9474:Ankib1 UTSW 5 3755617 missense probably damaging 0.98
R9504:Ankib1 UTSW 5 3713235 missense probably benign
R9564:Ankib1 UTSW 5 3755733 missense possibly damaging 0.87
Z1088:Ankib1 UTSW 5 3713136 missense probably damaging 1.00
Z1088:Ankib1 UTSW 5 3713137 nonsense probably null
Z1176:Ankib1 UTSW 5 3692763 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACACAGGCTTTCATCCCCG -3'
(R):5'- GTGACACACCTCAATAGAAATTGG -3'

Sequencing Primer
(F):5'- TTTCATCCCCGAGGCTGCAG -3'
(R):5'- CACCTCAATAGAAATTGGACTTTAGC -3'
Posted On 2021-11-19