Incidental Mutation 'R0564:Ankib1'
ID 46059
Institutional Source Beutler Lab
Gene Symbol Ankib1
Ensembl Gene ENSMUSG00000040351
Gene Name ankyrin repeat and IBR domain containing 1
Synonyms 2310061P20Rik, 4631416I11Rik
MMRRC Submission 038755-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0564 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 3690000-3802925 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 3729655 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 405 (Y405H)
Ref Sequence ENSEMBL: ENSMUSP00000040946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043551] [ENSMUST00000200335]
AlphaFold Q6ZPS6
Predicted Effect probably damaging
Transcript: ENSMUST00000043551
AA Change: Y405H

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040946
Gene: ENSMUSG00000040351
AA Change: Y405H

DomainStartEndE-ValueType
ANK 45 75 7.08e-1 SMART
ANK 145 174 2.32e-5 SMART
low complexity region 209 219 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
RING 334 382 9.73e-2 SMART
IBR 403 479 8.72e-12 SMART
IBR 502 566 2.59e-5 SMART
RING 520 644 2.36e0 SMART
low complexity region 764 773 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
UIM 846 865 3.62e-1 SMART
low complexity region 905 917 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199763
Predicted Effect possibly damaging
Transcript: ENSMUST00000200335
AA Change: Y405H

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142687
Gene: ENSMUSG00000040351
AA Change: Y405H

DomainStartEndE-ValueType
ANK 45 75 4.5e-3 SMART
ANK 145 174 1.4e-7 SMART
low complexity region 209 219 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
RING 334 382 4.6e-4 SMART
IBR 403 479 2.9e-14 SMART
IBR 502 566 8.3e-8 SMART
RING 520 644 1.1e-2 SMART
low complexity region 768 779 N/A INTRINSIC
Meta Mutation Damage Score 0.9109 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 A G 10: 80,344,847 V127A probably damaging Het
Alox12 T A 11: 70,252,836 D202V probably damaging Het
Apbb2 A T 5: 66,452,250 M18K probably damaging Het
Atad2 C A 15: 58,125,833 probably benign Het
BC117090 A T 16: 36,322,984 Y34* probably null Het
Birc6 T A 17: 74,625,243 probably benign Het
Ccdc126 T C 6: 49,334,142 M28T possibly damaging Het
Cdc16 A T 8: 13,781,618 D617V probably damaging Het
Cep135 G A 5: 76,615,710 E516K probably damaging Het
Cep135 G T 5: 76,638,949 M1081I probably benign Het
Col6a3 A C 1: 90,807,734 V731G probably damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
D230025D16Rik T A 8: 105,239,971 probably benign Het
Dip2b C A 15: 100,162,719 Y258* probably null Het
Dnah17 A G 11: 118,082,981 V1900A probably damaging Het
Dpysl2 A T 14: 66,805,446 probably benign Het
Dync2h1 A T 9: 7,139,432 L1401Q probably damaging Het
Esf1 A T 2: 140,158,586 Y427N possibly damaging Het
Fbln1 T A 15: 85,227,107 V154D probably benign Het
Frem2 A G 3: 53,656,109 F326L probably damaging Het
Gm4922 T A 10: 18,784,065 N303I possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Iigp1 G A 18: 60,390,451 V214M probably damaging Het
Luzp2 A G 7: 54,835,962 K2E probably damaging Het
Mcc A G 18: 44,468,507 L410P probably damaging Het
Mfn2 A G 4: 147,883,255 F452S probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Micu2 A G 14: 57,919,374 F335L possibly damaging Het
Mpp3 T G 11: 102,005,347 K450T possibly damaging Het
Mtmr4 T A 11: 87,598,888 V79E probably damaging Het
Nlrp4b A G 7: 10,714,658 I263V probably benign Het
Olfr551 T C 7: 102,588,531 I71V probably benign Het
Olfr809 T G 10: 129,776,136 V74G probably damaging Het
Pdk1 G A 2: 71,880,039 W113* probably null Het
Phxr4 A T 9: 13,431,697 probably benign Het
Rad51ap2 T A 12: 11,457,896 H606Q probably benign Het
Ralgapa1 A T 12: 55,782,885 I187K possibly damaging Het
Rps27 A G 3: 90,212,923 probably benign Het
Sema3e T A 5: 14,236,085 probably null Het
Sh2d3c G A 2: 32,753,052 C749Y probably damaging Het
Siah2 T C 3: 58,676,235 D210G probably benign Het
Smap2 G A 4: 120,976,977 P155S probably benign Het
Snrk C T 9: 122,166,544 T463M possibly damaging Het
Tm9sf3 A G 19: 41,245,525 probably benign Het
Tmem132d C T 5: 127,784,778 E760K probably damaging Het
Tmem184c A T 8: 77,606,160 probably null Het
Tmem235 A T 11: 117,860,848 I33F possibly damaging Het
Tmem267 A T 13: 119,492,639 probably null Het
Top1 G A 2: 160,714,265 R548Q probably damaging Het
Trio T C 15: 27,805,822 N527D probably damaging Het
Upf3a A G 8: 13,795,656 K252E probably benign Het
Other mutations in Ankib1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Ankib1 APN 5 3727573 missense probably benign 0.20
IGL01329:Ankib1 APN 5 3734194 splice site probably benign
IGL01372:Ankib1 APN 5 3772594 missense probably damaging 1.00
IGL01593:Ankib1 APN 5 3732590 missense probably benign 0.00
IGL01613:Ankib1 APN 5 3713146 nonsense probably null
IGL01728:Ankib1 APN 5 3701992 splice site probably benign
IGL01782:Ankib1 APN 5 3727607 missense probably damaging 1.00
IGL01878:Ankib1 APN 5 3734152 missense possibly damaging 0.69
IGL02730:Ankib1 APN 5 3702995 missense probably damaging 1.00
IGL02742:Ankib1 APN 5 3693479 missense probably benign 0.04
IGL02873:Ankib1 APN 5 3772619 missense probably damaging 1.00
R0033:Ankib1 UTSW 5 3769588 missense possibly damaging 0.52
R0242:Ankib1 UTSW 5 3700344 splice site probably benign
R0632:Ankib1 UTSW 5 3772529 missense probably benign 0.02
R0732:Ankib1 UTSW 5 3713163 missense possibly damaging 0.89
R1678:Ankib1 UTSW 5 3706301 missense probably damaging 0.99
R1816:Ankib1 UTSW 5 3734028 missense probably benign 0.05
R2165:Ankib1 UTSW 5 3713210 missense possibly damaging 0.69
R3434:Ankib1 UTSW 5 3692760 missense probably damaging 1.00
R3749:Ankib1 UTSW 5 3734097 missense probably damaging 0.98
R4745:Ankib1 UTSW 5 3732566 missense probably damaging 1.00
R4827:Ankib1 UTSW 5 3701907 missense probably damaging 1.00
R4983:Ankib1 UTSW 5 3769652 missense probably benign 0.09
R4989:Ankib1 UTSW 5 3713217 missense probably damaging 0.99
R5022:Ankib1 UTSW 5 3734011 missense possibly damaging 0.96
R5057:Ankib1 UTSW 5 3734011 missense possibly damaging 0.96
R5510:Ankib1 UTSW 5 3729693 missense probably benign 0.02
R5606:Ankib1 UTSW 5 3701907 missense probably damaging 1.00
R5910:Ankib1 UTSW 5 3693217 missense probably benign
R5929:Ankib1 UTSW 5 3769633 missense possibly damaging 0.86
R5986:Ankib1 UTSW 5 3747071 missense probably damaging 1.00
R6281:Ankib1 UTSW 5 3701965 missense possibly damaging 0.70
R6336:Ankib1 UTSW 5 3700377 nonsense probably null
R6377:Ankib1 UTSW 5 3693855 missense possibly damaging 0.78
R7001:Ankib1 UTSW 5 3694781 missense probably benign
R7264:Ankib1 UTSW 5 3755739 missense probably damaging 1.00
R7380:Ankib1 UTSW 5 3722576 missense probably benign 0.03
R7402:Ankib1 UTSW 5 3769586 missense probably benign 0.01
R7491:Ankib1 UTSW 5 3701911 missense probably damaging 1.00
R7525:Ankib1 UTSW 5 3755734 missense possibly damaging 0.95
R7562:Ankib1 UTSW 5 3747021 missense probably null 1.00
R8116:Ankib1 UTSW 5 3702995 missense probably damaging 1.00
R8347:Ankib1 UTSW 5 3747065 missense probably damaging 1.00
R8712:Ankib1 UTSW 5 3772643 missense probably benign 0.03
R8750:Ankib1 UTSW 5 3702890 critical splice donor site probably null
R8854:Ankib1 UTSW 5 3727489 missense probably null 0.97
R9032:Ankib1 UTSW 5 3769641 missense probably benign 0.16
R9180:Ankib1 UTSW 5 3706276 missense probably damaging 1.00
R9325:Ankib1 UTSW 5 3772523 missense possibly damaging 0.81
R9474:Ankib1 UTSW 5 3755617 missense probably damaging 0.98
R9504:Ankib1 UTSW 5 3713235 missense probably benign
R9564:Ankib1 UTSW 5 3755733 missense possibly damaging 0.87
Z1088:Ankib1 UTSW 5 3713136 missense probably damaging 1.00
Z1088:Ankib1 UTSW 5 3713137 nonsense probably null
Z1176:Ankib1 UTSW 5 3692763 missense probably benign
Predicted Primers PCR Primer
(F):5'- tcctggcaGTTTGCCAACGTTT -3'
(R):5'- GCAGTGTCTGGCAGTGTAAGAGAG -3'

Sequencing Primer
(F):5'- TCAGTTATAAAAAAGGGACAACAGC -3'
(R):5'- TAAGCCCAGGTCTTGGTGAATAC -3'
Posted On 2013-06-11