Mutagenetix > Incidental Mutation

Incidental Mutation 'R8772:Plxnb2'

664495

Institutional Source

Beutler Lab

Gene Symbol

Plxnb2

Ensembl Gene

ENSMUSG00000036606

Gene Name

plexin B2

Synonyms

Debt, 1110007H23Rik

MMRRC Submission

068626-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.955) question?

Stock #

R8772 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

89155549-89180788 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 89162746 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 791 (V791M)

Ref Sequence

ENSEMBL: ENSMUSP00000051731 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]

AlphaFold

B2RXS4

Predicted Effect

probably damaging
Transcript: ENSMUST00000060808
AA Change: V791M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606
AA Change: V791M

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	34	452	8.87e-92	SMART
PSI	470	521	1.94e-10	SMART
PSI	616	669	4.09e-1	SMART
PSI	761	804	7.02e-8	SMART
IPT	805	896	8.14e-19	SMART
IPT	897	983	1.1e-15	SMART
IPT	985	1096	5.06e-6	SMART
Pfam:Plexin_cytopl	1275	1809	1.6e-225	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000109331
AA Change: V791M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606
AA Change: V791M

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	34	452	8.87e-92	SMART
PSI	470	521	1.94e-10	SMART
PSI	616	669	4.09e-1	SMART
PSI	761	804	7.02e-8	SMART
IPT	805	896	8.14e-19	SMART
IPT	897	983	1.1e-15	SMART
IPT	985	1096	5.06e-6	SMART
Pfam:Plexin_cytopl	1274	1809	4.4e-251	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.8%

Validation Efficiency

100% (83/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	T	C	17: 45,516,977	V574A	probably benign	Het
AC157566.4	T	C	15: 76,534,249	Y20C	probably benign	Het
Acacb	A	T	5: 114,184,118	D231V	possibly damaging	Het
Acp7	C	T	7: 28,616,484	V226M	probably damaging	Het
Actr1a	A	G	19: 46,382,292		probably null	Het
Adamts16	T	C	13: 70,836,334	Y70C	probably damaging	Het
Adcy5	G	A	16: 35,299,588	A1156T	probably damaging	Het
Ago1	A	T	4: 126,460,523		probably benign	Het
Akap9	G	A	5: 4,046,255	E2377K	probably damaging	Het
Asic2	A	G	11: 81,967,887	S100P	probably benign	Het
Atp1a1	A	C	3: 101,579,808	V895G	probably benign	Het
B3gnt7	A	G	1: 86,305,572	E180G	possibly damaging	Het
Cacna1c	A	T	6: 118,602,322	F1805I		Het
Cacna1g	A	G	11: 94,465,887	I141T	probably benign	Het
Ccdc162	A	G	10: 41,630,037	L919P	probably damaging	Het
Cd47	A	G	16: 49,884,212	I116V		Het
Cdca2	A	T	14: 67,698,080	D395E	probably damaging	Het
Celsr2	A	T	3: 108,397,073	I2285N	possibly damaging	Het
Chil5	T	C	3: 106,018,220	D157G	probably damaging	Het
Ciita	A	T	16: 10,480,162	I7F	probably damaging	Het
Dok7	G	T	5: 35,077,249	G215C	probably damaging	Het
Eif2s2	T	C	2: 154,887,739	I88V	probably null	Het
Fasn	A	T	11: 120,820,536	D217E	probably benign	Het
Fgd5	T	A	6: 92,050,419	I1030N	probably damaging	Het
Fpr-rs6	T	A	17: 20,182,233	N289Y	probably damaging	Het
Gm10392	C	T	11: 77,518,454	V49I	possibly damaging	Het
Gtf3c2	A	T	5: 31,174,414	M20K	probably benign	Het
Hoga1	A	G	19: 42,045,945	M10V	probably benign	Het
Homer1	T	A	13: 93,391,731	V258E	probably damaging	Het
Ifitm2	A	G	7: 140,955,890	L9S	probably benign	Het
Iqgap3	G	A	3: 88,089,837	A176T	probably benign	Het
Itga8	C	G	2: 12,182,684	G728A	probably damaging	Het
Lyst	C	T	13: 13,637,492	Q830*	probably null	Het
Macc1	T	C	12: 119,447,485	W663R	probably damaging	Het
Mipol1	A	T	12: 57,325,632	H159L	probably benign	Het
Mocs1	T	A	17: 49,450,374		probably null	Het
Ncoa1	T	C	12: 4,322,940	T154A	possibly damaging	Het
Noxred1	A	C	12: 87,227,093	L58R	probably benign	Het
Olfr205	A	G	16: 59,328,688	S274P	probably damaging	Het
Olfr78	G	A	7: 102,743,003		probably benign	Het
Olfr895	G	A	9: 38,268,935	V133I	probably benign	Het
Opcml	T	C	9: 27,791,411	V9A	probably benign	Het
Otog	A	T	7: 46,284,928	R1303S	probably damaging	Het
Parp11	T	A	6: 127,470,763	M20K	possibly damaging	Het
Parp11	T	A	6: 127,491,704	I322N	probably damaging	Het
Pde1b	T	C	15: 103,525,121		probably benign	Het
Pglyrp4	A	T	3: 90,740,400	T356S	possibly damaging	Het
Pitrm1	A	G	13: 6,578,560	D963G	probably damaging	Het
Plod3	T	C	5: 136,988,919	V183A	probably damaging	Het
Poc1b	T	A	10: 99,156,357		probably benign	Het
Ppp1r7	A	G	1: 93,354,428	T234A	probably benign	Het
Pxdn	C	T	12: 30,015,464	T1441I	probably damaging	Het
Rap1gap2	T	C	11: 74,405,725	K479E	probably damaging	Het
Rars2	A	G	4: 34,623,488	D63G	probably benign	Het
Rptor	A	C	11: 119,725,032	D124A	probably damaging	Het
Rsf1	CG	CGACGGCGGTG	7: 97,579,908		probably benign	Het
Ryr1	C	A	7: 29,116,132	R118L	probably benign	Het
Sap130	G	C	18: 31,680,464	D525H	probably damaging	Het
Slc22a26	T	C	19: 7,790,112	N310D	probably benign	Het
Slc46a1	T	G	11: 78,465,951	N58K	probably benign	Het
Slc4a10	T	A	2: 62,303,940	I1000N	probably damaging	Het
Son	C	T	16: 91,657,938	T1191I	possibly damaging	Het
Sppl2a	T	C	2: 126,926,311	K146E	probably benign	Het
Srgap3	T	A	6: 112,766,945	K444I	probably damaging	Het
Sun1	T	C	5: 139,223,692	V59A	probably benign	Het
Sva	T	A	6: 42,038,509	Y37N	probably benign	Het
Taar8c	T	A	10: 24,101,807	M36L	probably benign	Het
Taf4b	C	T	18: 14,835,852	T682I	probably damaging	Het
Tbx5	T	A	5: 119,838,725	H59Q	probably benign	Het
Tdrd1	A	T	19: 56,855,328	Y746F	probably damaging	Het
Tmem132e	A	G	11: 82,434,311	S46G	probably damaging	Het
Tnfaip6	T	A	2: 52,051,065	V206E	possibly damaging	Het
Tpbpb	T	A	13: 60,901,379		probably benign	Het
Ttn	T	A	2: 76,937,681	K3025*	probably null	Het
Tulp4	T	A	17: 6,176,893	I106N	probably damaging	Het
Ubp1	T	A	9: 113,972,829	F454Y	probably benign	Het
Ugt2b37	A	T	5: 87,254,486	N95K	probably benign	Het
Vps13d	T	A	4: 145,075,032	R3539W		Het
Vsnl1	T	C	12: 11,332,179	H67R	probably damaging	Het
Zbbx	A	G	3: 75,155,385	Y22H	probably benign	Het
Zeb1	A	G	18: 5,770,382		probably null	Het
Zfp142	A	T	1: 74,571,666	L990Q	possibly damaging	Het
Zmiz1	G	A	14: 25,645,694	G265D	probably damaging	Het

Other mutations in Plxnb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00546:Plxnb2	APN	15	89162366	splice site	probably benign
IGL01574:Plxnb2	APN	15	89162683	splice site	probably null
IGL01695:Plxnb2	APN	15	89157214	missense	possibly damaging	0.96
IGL01763:Plxnb2	APN	15	89161981	splice site	probably null
IGL01921:Plxnb2	APN	15	89164271	missense	possibly damaging	0.78
IGL02129:Plxnb2	APN	15	89160410	missense	probably benign	0.04
IGL02153:Plxnb2	APN	15	89165813	nonsense	probably null
IGL02637:Plxnb2	APN	15	89164057	missense	possibly damaging	0.53
IGL02892:Plxnb2	APN	15	89161222	critical splice donor site	probably null
IGL03108:Plxnb2	APN	15	89158031	missense	probably benign	0.32
IGL03115:Plxnb2	APN	15	89162438	splice site	probably benign
P0040:Plxnb2	UTSW	15	89162935	missense	probably damaging	1.00
R0022:Plxnb2	UTSW	15	89163276	critical splice donor site	probably null
R0095:Plxnb2	UTSW	15	89165331	missense	probably benign
R0103:Plxnb2	UTSW	15	89161769	missense	possibly damaging	0.85
R0544:Plxnb2	UTSW	15	89158613	splice site	probably benign
R0671:Plxnb2	UTSW	15	89157981	missense	probably benign	0.14
R1279:Plxnb2	UTSW	15	89162321	missense	probably benign	0.02
R1530:Plxnb2	UTSW	15	89167192	missense	probably benign
R1542:Plxnb2	UTSW	15	89165921	missense	probably damaging	1.00
R1610:Plxnb2	UTSW	15	89158493	missense	probably damaging	1.00
R1686:Plxnb2	UTSW	15	89162462	missense	probably damaging	1.00
R1702:Plxnb2	UTSW	15	89161984	critical splice donor site	probably null
R1996:Plxnb2	UTSW	15	89158768	missense	probably benign	0.13
R1997:Plxnb2	UTSW	15	89158768	missense	probably benign	0.13
R2031:Plxnb2	UTSW	15	89162810	nonsense	probably null
R2049:Plxnb2	UTSW	15	89159002	missense	probably damaging	1.00
R2072:Plxnb2	UTSW	15	89158451	missense	probably damaging	1.00
R2076:Plxnb2	UTSW	15	89158026	missense	probably damaging	1.00
R2140:Plxnb2	UTSW	15	89156562	missense	probably benign	0.04
R2418:Plxnb2	UTSW	15	89161069	missense	possibly damaging	0.72
R2419:Plxnb2	UTSW	15	89161069	missense	possibly damaging	0.72
R3752:Plxnb2	UTSW	15	89157255	splice site	probably benign
R3825:Plxnb2	UTSW	15	89166399	missense	probably benign	0.05
R4154:Plxnb2	UTSW	15	89159642	missense	probably damaging	0.98
R4197:Plxnb2	UTSW	15	89157018	missense	probably damaging	1.00
R4385:Plxnb2	UTSW	15	89160623	missense	probably damaging	0.96
R4434:Plxnb2	UTSW	15	89162803	missense	probably damaging	1.00
R4678:Plxnb2	UTSW	15	89160928	missense	probably benign	0.37
R4717:Plxnb2	UTSW	15	89157419	nonsense	probably null
R4773:Plxnb2	UTSW	15	89166947	missense	probably benign	0.06
R4905:Plxnb2	UTSW	15	89157411	missense	probably damaging	1.00
R5368:Plxnb2	UTSW	15	89159593	missense	possibly damaging	0.94
R5418:Plxnb2	UTSW	15	89166491	missense	probably benign	0.00
R5484:Plxnb2	UTSW	15	89164209	splice site	probably null
R5520:Plxnb2	UTSW	15	89167543	missense	possibly damaging	0.65
R5566:Plxnb2	UTSW	15	89164020	missense	probably benign	0.05
R5568:Plxnb2	UTSW	15	89157435	missense	probably damaging	1.00
R5619:Plxnb2	UTSW	15	89162809	missense	possibly damaging	0.92
R5685:Plxnb2	UTSW	15	89167032	missense	probably damaging	1.00
R5688:Plxnb2	UTSW	15	89158696	missense	probably damaging	1.00
R5809:Plxnb2	UTSW	15	89167571	missense	possibly damaging	0.61
R5813:Plxnb2	UTSW	15	89160759	missense	possibly damaging	0.81
R5866:Plxnb2	UTSW	15	89167572	missense	probably damaging	1.00
R6016:Plxnb2	UTSW	15	89161022	missense	possibly damaging	0.55
R6117:Plxnb2	UTSW	15	89158000	missense	probably benign	0.04
R6187:Plxnb2	UTSW	15	89167258	missense	probably damaging	1.00
R6260:Plxnb2	UTSW	15	89165291	missense	probably benign	0.22
R6263:Plxnb2	UTSW	15	89161986	missense	probably damaging	0.99
R6269:Plxnb2	UTSW	15	89160713	missense	probably benign	0.18
R6351:Plxnb2	UTSW	15	89157770	missense	possibly damaging	0.95
R6522:Plxnb2	UTSW	15	89164426	missense	probably benign	0.18
R6856:Plxnb2	UTSW	15	89164320	missense	probably benign	0.27
R6930:Plxnb2	UTSW	15	89160389	missense	probably benign
R7354:Plxnb2	UTSW	15	89165725	missense	possibly damaging	0.92
R7513:Plxnb2	UTSW	15	89158322	critical splice acceptor site	probably null
R7522:Plxnb2	UTSW	15	89161774	missense	probably benign	0.20
R7730:Plxnb2	UTSW	15	89162330	missense	probably benign
R7766:Plxnb2	UTSW	15	89161271	missense	probably benign	0.01
R7781:Plxnb2	UTSW	15	89157022	missense	possibly damaging	0.89
R8126:Plxnb2	UTSW	15	89163303	missense	probably benign
R8131:Plxnb2	UTSW	15	89158713	missense	probably damaging	1.00
R8372:Plxnb2	UTSW	15	89158493	missense	probably damaging	1.00
R8736:Plxnb2	UTSW	15	89162058	missense	probably damaging	1.00
R9022:Plxnb2	UTSW	15	89164268	missense	possibly damaging	0.59
R9044:Plxnb2	UTSW	15	89160363	splice site	probably benign
R9253:Plxnb2	UTSW	15	89167812	missense	probably benign
R9398:Plxnb2	UTSW	15	89160919	missense	probably benign	0.02
R9562:Plxnb2	UTSW	15	89165933	missense	probably damaging	1.00
R9568:Plxnb2	UTSW	15	89160957	nonsense	probably null
R9613:Plxnb2	UTSW	15	89164293	missense	probably benign	0.01
X0027:Plxnb2	UTSW	15	89160713	missense	probably benign	0.18
Z1177:Plxnb2	UTSW	15	89159096	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGACCCATGGATAGTGACC -3'
(R):5'- ACATTGACAGCAAGCTACAAGG -3'

Sequencing Primer
(F):5'- CATGGATAGTGACCAGGATGCCC -3'
(R):5'- TTGACAGCAAGCTACAAGGTAGGG -3'

Posted On

2021-03-08