Incidental Mutation 'R8772:Plxnb2'
ID664495
Institutional Source Beutler Lab
Gene Symbol Plxnb2
Ensembl Gene ENSMUSG00000036606
Gene Nameplexin B2
SynonymsDebt, 1110007H23Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R8772 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location89155549-89180788 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89162746 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 791 (V791M)
Ref Sequence ENSEMBL: ENSMUSP00000051731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]
Predicted Effect probably damaging
Transcript: ENSMUST00000060808
AA Change: V791M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606
AA Change: V791M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1275 1809 1.6e-225 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109331
AA Change: V791M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606
AA Change: V791M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1274 1809 4.4e-251 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T C 17: 45,516,977 V574A probably benign Het
AC157566.4 T C 15: 76,534,249 Y20C probably benign Het
Acacb A T 5: 114,184,118 D231V possibly damaging Het
Acp7 C T 7: 28,616,484 V226M probably damaging Het
Actr1a A G 19: 46,382,292 probably null Het
Adamts16 T C 13: 70,836,334 Y70C probably damaging Het
Adcy5 G A 16: 35,299,588 A1156T probably damaging Het
Akap9 G A 5: 4,046,255 E2377K probably damaging Het
Asic2 A G 11: 81,967,887 S100P probably benign Het
Atp1a1 A C 3: 101,579,808 V895G probably benign Het
B3gnt7 A G 1: 86,305,572 E180G possibly damaging Het
Cacna1c A T 6: 118,602,322 F1805I Het
Cacna1g A G 11: 94,465,887 I141T probably benign Het
Ccdc162 A G 10: 41,630,037 L919P probably damaging Het
Cd47 A G 16: 49,884,212 I116V Het
Cdca2 A T 14: 67,698,080 D395E probably damaging Het
Celsr2 A T 3: 108,397,073 I2285N possibly damaging Het
Chil5 T C 3: 106,018,220 D157G probably damaging Het
Ciita A T 16: 10,480,162 I7F probably damaging Het
Dok7 G T 5: 35,077,249 G215C probably damaging Het
Eif2s2 T C 2: 154,887,739 I88V probably null Het
Fasn A T 11: 120,820,536 D217E probably benign Het
Fgd5 T A 6: 92,050,419 I1030N probably damaging Het
Fpr-rs6 T A 17: 20,182,233 N289Y probably damaging Het
Gm10392 C T 11: 77,518,454 V49I possibly damaging Het
Gtf3c2 A T 5: 31,174,414 M20K probably benign Het
Hoga1 A G 19: 42,045,945 M10V probably benign Het
Homer1 T A 13: 93,391,731 V258E probably damaging Het
Ifitm2 A G 7: 140,955,890 L9S probably benign Het
Iqgap3 G A 3: 88,089,837 A176T probably benign Het
Itga8 C G 2: 12,182,684 G728A probably damaging Het
Lyst C T 13: 13,637,492 Q830* probably null Het
Macc1 T C 12: 119,447,485 W663R probably damaging Het
Mipol1 A T 12: 57,325,632 H159L probably benign Het
Mocs1 T A 17: 49,450,374 probably null Het
Ncoa1 T C 12: 4,322,940 T154A possibly damaging Het
Noxred1 A C 12: 87,227,093 L58R probably benign Het
Olfr205 A G 16: 59,328,688 S274P probably damaging Het
Olfr78 G A 7: 102,743,003 probably benign Het
Olfr895 G A 9: 38,268,935 V133I probably benign Het
Opcml T C 9: 27,791,411 V9A probably benign Het
Otog A T 7: 46,284,928 R1303S probably damaging Het
Parp11 T A 6: 127,470,763 M20K possibly damaging Het
Parp11 T A 6: 127,491,704 I322N probably damaging Het
Pglyrp4 A T 3: 90,740,400 T356S possibly damaging Het
Pitrm1 A G 13: 6,578,560 D963G probably damaging Het
Plod3 T C 5: 136,988,919 V183A probably damaging Het
Ppp1r7 A G 1: 93,354,428 T234A probably benign Het
Pxdn C T 12: 30,015,464 T1441I probably damaging Het
Rap1gap2 T C 11: 74,405,725 K479E probably damaging Het
Rars2 A G 4: 34,623,488 D63G probably benign Het
Rptor A C 11: 119,725,032 D124A probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Ryr1 C A 7: 29,116,132 R118L probably benign Het
Sap130 G C 18: 31,680,464 D525H probably damaging Het
Slc22a26 T C 19: 7,790,112 N310D probably benign Het
Slc46a1 T G 11: 78,465,951 N58K probably benign Het
Slc4a10 T A 2: 62,303,940 I1000N probably damaging Het
Son C T 16: 91,657,938 T1191I possibly damaging Het
Sppl2a T C 2: 126,926,311 K146E probably benign Het
Srgap3 T A 6: 112,766,945 K444I probably damaging Het
Sun1 T C 5: 139,223,692 V59A probably benign Het
Sva T A 6: 42,038,509 Y37N probably benign Het
Taar8c T A 10: 24,101,807 M36L probably benign Het
Taf4b C T 18: 14,835,852 T682I probably damaging Het
Tbx5 T A 5: 119,838,725 H59Q probably benign Het
Tdrd1 A T 19: 56,855,328 Y746F probably damaging Het
Tmem132e A G 11: 82,434,311 S46G probably damaging Het
Tnfaip6 T A 2: 52,051,065 V206E possibly damaging Het
Ttn T A 2: 76,937,681 K3025* probably null Het
Tulp4 T A 17: 6,176,893 I106N probably damaging Het
Ubp1 T A 9: 113,972,829 F454Y probably benign Het
Ugt2b37 A T 5: 87,254,486 N95K probably benign Het
Vps13d T A 4: 145,075,032 R3539W Het
Vsnl1 T C 12: 11,332,179 H67R probably damaging Het
Zbbx A G 3: 75,155,385 Y22H probably benign Het
Zeb1 A G 18: 5,770,382 probably null Het
Zfp142 A T 1: 74,571,666 L990Q possibly damaging Het
Zmiz1 G A 14: 25,645,694 G265D probably damaging Het
Other mutations in Plxnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Plxnb2 APN 15 89162366 splice site probably benign
IGL01574:Plxnb2 APN 15 89162683 splice site probably null
IGL01695:Plxnb2 APN 15 89157214 missense possibly damaging 0.96
IGL01763:Plxnb2 APN 15 89161981 splice site probably null
IGL01921:Plxnb2 APN 15 89164271 missense possibly damaging 0.78
IGL02129:Plxnb2 APN 15 89160410 missense probably benign 0.04
IGL02153:Plxnb2 APN 15 89165813 nonsense probably null
IGL02637:Plxnb2 APN 15 89164057 missense possibly damaging 0.53
IGL02892:Plxnb2 APN 15 89161222 critical splice donor site probably null
IGL03108:Plxnb2 APN 15 89158031 missense probably benign 0.32
IGL03115:Plxnb2 APN 15 89162438 splice site probably benign
P0040:Plxnb2 UTSW 15 89162935 missense probably damaging 1.00
R0022:Plxnb2 UTSW 15 89163276 critical splice donor site probably null
R0095:Plxnb2 UTSW 15 89165331 missense probably benign
R0103:Plxnb2 UTSW 15 89161769 missense possibly damaging 0.85
R0544:Plxnb2 UTSW 15 89158613 splice site probably benign
R0671:Plxnb2 UTSW 15 89157981 missense probably benign 0.14
R1279:Plxnb2 UTSW 15 89162321 missense probably benign 0.02
R1530:Plxnb2 UTSW 15 89167192 missense probably benign
R1542:Plxnb2 UTSW 15 89165921 missense probably damaging 1.00
R1610:Plxnb2 UTSW 15 89158493 missense probably damaging 1.00
R1686:Plxnb2 UTSW 15 89162462 missense probably damaging 1.00
R1702:Plxnb2 UTSW 15 89161984 critical splice donor site probably null
R1996:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R1997:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R2031:Plxnb2 UTSW 15 89162810 nonsense probably null
R2049:Plxnb2 UTSW 15 89159002 missense probably damaging 1.00
R2072:Plxnb2 UTSW 15 89158451 missense probably damaging 1.00
R2076:Plxnb2 UTSW 15 89158026 missense probably damaging 1.00
R2140:Plxnb2 UTSW 15 89156562 missense probably benign 0.04
R2418:Plxnb2 UTSW 15 89161069 missense possibly damaging 0.72
R2419:Plxnb2 UTSW 15 89161069 missense possibly damaging 0.72
R3752:Plxnb2 UTSW 15 89157255 splice site probably benign
R3825:Plxnb2 UTSW 15 89166399 missense probably benign 0.05
R4154:Plxnb2 UTSW 15 89159642 missense probably damaging 0.98
R4197:Plxnb2 UTSW 15 89157018 missense probably damaging 1.00
R4385:Plxnb2 UTSW 15 89160623 missense probably damaging 0.96
R4434:Plxnb2 UTSW 15 89162803 missense probably damaging 1.00
R4678:Plxnb2 UTSW 15 89160928 missense probably benign 0.37
R4717:Plxnb2 UTSW 15 89157419 nonsense probably null
R4773:Plxnb2 UTSW 15 89166947 missense probably benign 0.06
R4905:Plxnb2 UTSW 15 89157411 missense probably damaging 1.00
R5368:Plxnb2 UTSW 15 89159593 missense possibly damaging 0.94
R5418:Plxnb2 UTSW 15 89166491 missense probably benign 0.00
R5484:Plxnb2 UTSW 15 89164209 splice site probably null
R5520:Plxnb2 UTSW 15 89167543 missense possibly damaging 0.65
R5566:Plxnb2 UTSW 15 89164020 missense probably benign 0.05
R5568:Plxnb2 UTSW 15 89157435 missense probably damaging 1.00
R5619:Plxnb2 UTSW 15 89162809 missense possibly damaging 0.92
R5685:Plxnb2 UTSW 15 89167032 missense probably damaging 1.00
R5688:Plxnb2 UTSW 15 89158696 missense probably damaging 1.00
R5809:Plxnb2 UTSW 15 89167571 missense possibly damaging 0.61
R5813:Plxnb2 UTSW 15 89160759 missense possibly damaging 0.81
R5866:Plxnb2 UTSW 15 89167572 missense probably damaging 1.00
R6016:Plxnb2 UTSW 15 89161022 missense possibly damaging 0.55
R6117:Plxnb2 UTSW 15 89158000 missense probably benign 0.04
R6187:Plxnb2 UTSW 15 89167258 missense probably damaging 1.00
R6260:Plxnb2 UTSW 15 89165291 missense probably benign 0.22
R6263:Plxnb2 UTSW 15 89161986 missense probably damaging 0.99
R6269:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
R6351:Plxnb2 UTSW 15 89157770 missense possibly damaging 0.95
R6522:Plxnb2 UTSW 15 89164426 missense probably benign 0.18
R6856:Plxnb2 UTSW 15 89164320 missense probably benign 0.27
R6930:Plxnb2 UTSW 15 89160389 missense probably benign
R7354:Plxnb2 UTSW 15 89165725 missense possibly damaging 0.92
R7513:Plxnb2 UTSW 15 89158322 critical splice acceptor site probably null
R7522:Plxnb2 UTSW 15 89161774 missense probably benign 0.20
R7730:Plxnb2 UTSW 15 89162330 missense probably benign
R7766:Plxnb2 UTSW 15 89161271 missense probably benign 0.01
R7781:Plxnb2 UTSW 15 89157022 missense possibly damaging 0.89
R8126:Plxnb2 UTSW 15 89163303 missense probably benign
R8131:Plxnb2 UTSW 15 89158713 missense probably damaging 1.00
R8372:Plxnb2 UTSW 15 89158493 missense probably damaging 1.00
R8736:Plxnb2 UTSW 15 89162058 missense probably damaging 1.00
X0027:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
Z1177:Plxnb2 UTSW 15 89159096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACCCATGGATAGTGACC -3'
(R):5'- ACATTGACAGCAAGCTACAAGG -3'

Sequencing Primer
(F):5'- CATGGATAGTGACCAGGATGCCC -3'
(R):5'- TTGACAGCAAGCTACAAGGTAGGG -3'
Posted On2021-03-08