Incidental Mutation 'R8715:Nphp1'
ID 669799
Institutional Source Beutler Lab
Gene Symbol Nphp1
Ensembl Gene ENSMUSG00000027378
Gene Name nephronophthisis 1 (juvenile) homolog (human)
Synonyms nephrocystin
MMRRC Submission 068613-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8715 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 127582652-127630817 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 127605729 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 365 (H365Q)
Ref Sequence ENSEMBL: ENSMUSP00000028857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028857] [ENSMUST00000110357]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000028857
AA Change: H365Q

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028857
Gene: ENSMUSG00000027378
AA Change: H365Q

DomainStartEndE-ValueType
low complexity region 118 143 N/A INTRINSIC
SH3 158 214 5.91e-19 SMART
low complexity region 220 246 N/A INTRINSIC
Blast:14_3_3 391 491 3e-55 BLAST
low complexity region 634 641 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110357
AA Change: H364Q

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105986
Gene: ENSMUSG00000027378
AA Change: H364Q

DomainStartEndE-ValueType
low complexity region 118 143 N/A INTRINSIC
SH3 158 214 5.91e-19 SMART
low complexity region 220 246 N/A INTRINSIC
Blast:14_3_3 390 490 3e-55 BLAST
low complexity region 633 640 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with src homology domain 3 (SH3) patterns. This protein interacts with Crk-associated substrate, and it appears to function in the control of cell division, as well as in cell-cell and cell-matrix adhesion signaling, likely as part of a multifunctional complex localized in actin- and microtubule-based structures. Mutations in this gene cause familial juvenile nephronophthisis type 1, a kidney disorder involving both tubules and glomeruli. Defects in this gene are also associated with Senior-Loken syndrome type 1, also referred to as juvenile nephronophthisis with Leber amaurosis, which is characterized by kidney and eye disease, and with Joubert syndrome type 4, which is characterized by cerebellar ataxia, oculomotor apraxia, psychomotor delay and neonatal breathing abnormalities, sometimes including retinal dystrophy and renal disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male infertility due to defects in sperm maturation. Mice homozygous for another knock-out allele exhibit absent photoreceptor outer segment and photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b A T 5: 8,862,750 (GRCm39) H144L probably benign Het
Adam25 A G 8: 41,207,099 (GRCm39) N122D probably benign Het
Armc10 T C 5: 21,858,516 (GRCm39) F187S possibly damaging Het
Atosb A G 4: 43,033,944 (GRCm39) V444A possibly damaging Het
Best3 T A 10: 116,828,971 (GRCm39) F84I probably damaging Het
Card11 A T 5: 140,871,315 (GRCm39) D729E probably benign Het
Ccdc60 A T 5: 116,328,153 (GRCm39) F104I probably benign Het
Ccdc88b T C 19: 6,833,213 (GRCm39) E278G probably damaging Het
Cd209d CAT C 8: 3,923,772 (GRCm39) probably null Het
Cdhr4 G A 9: 107,874,596 (GRCm39) V9M Het
Cfap46 T C 7: 139,185,560 (GRCm39) T41A Het
Cyp2c66 A G 19: 39,159,388 (GRCm39) T280A probably benign Het
Dis3l C T 9: 64,214,342 (GRCm39) D1049N probably benign Het
Dlc1 T A 8: 37,405,795 (GRCm39) probably benign Het
Faap100 T C 11: 120,265,299 (GRCm39) T526A probably benign Het
Gimap6 A T 6: 48,679,552 (GRCm39) D161E probably damaging Het
Gmpr T C 13: 45,696,102 (GRCm39) V282A possibly damaging Het
Gsap A G 5: 21,431,245 (GRCm39) I190V possibly damaging Het
Gucy2d C T 7: 98,093,319 (GRCm39) T232I probably benign Het
Lgals4 C T 7: 28,540,921 (GRCm39) R282C probably damaging Het
Lrp1 C A 10: 127,396,490 (GRCm39) S2358I possibly damaging Het
Lrrc74a A G 12: 86,805,239 (GRCm39) N354D probably damaging Het
Mdga2 T C 12: 66,915,526 (GRCm39) E112G probably damaging Het
Msh6 C T 17: 88,293,195 (GRCm39) T650I probably benign Het
Mst1 T C 9: 107,959,242 (GRCm39) V203A possibly damaging Het
Muc1 G A 3: 89,138,821 (GRCm39) V477M possibly damaging Het
Naa11 A G 5: 97,540,066 (GRCm39) Y31H probably damaging Het
Or1p4-ps1 T A 11: 74,207,986 (GRCm39) I45N probably damaging Het
Or2y17 A T 11: 49,232,154 (GRCm39) Y265F probably damaging Het
Or5m13 G A 2: 85,748,273 (GRCm39) M1I probably null Het
Osbpl9 A G 4: 108,959,773 (GRCm39) F15S probably benign Het
Pcdha12 A C 18: 37,153,523 (GRCm39) N81H probably damaging Het
Pde4d A G 13: 110,071,876 (GRCm39) Q290R probably benign Het
Pla1a A T 16: 38,230,000 (GRCm39) N237K probably damaging Het
Podnl1 T C 8: 84,855,956 (GRCm39) Y239H Het
Pou4f3 G T 18: 42,528,593 (GRCm39) D179Y possibly damaging Het
Ptch2 T C 4: 116,968,719 (GRCm39) V995A probably damaging Het
Ptprt C T 2: 161,372,463 (GRCm39) C1403Y probably damaging Het
Rab7 T C 6: 87,989,369 (GRCm39) S34G probably damaging Het
Rspry1 A G 8: 95,349,888 (GRCm39) E92G probably damaging Het
Sdccag8 T A 1: 176,773,803 (GRCm39) probably benign Het
Sdk2 G A 11: 113,671,728 (GRCm39) T2140M probably damaging Het
Serpina1e T C 12: 103,917,177 (GRCm39) N164S probably benign Het
Shisal1 A C 15: 84,301,346 (GRCm39) V99G probably damaging Het
Tdrkh T C 3: 94,331,968 (GRCm39) V131A probably damaging Het
Tm9sf3 T A 19: 41,244,724 (GRCm39) N51I probably damaging Het
Trav4-3 A G 14: 53,836,762 (GRCm39) N76D possibly damaging Het
Trhr2 T A 8: 123,085,619 (GRCm39) I122F probably damaging Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Vmn2r99 A T 17: 19,613,922 (GRCm39) probably benign Het
Zfp663 T C 2: 165,194,644 (GRCm39) E525G probably damaging Het
Zfp976 C T 7: 42,262,869 (GRCm39) E324K possibly damaging Het
Other mutations in Nphp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Nphp1 APN 2 127,605,805 (GRCm39) missense probably damaging 0.99
IGL00589:Nphp1 APN 2 127,605,769 (GRCm39) missense probably damaging 1.00
IGL01143:Nphp1 APN 2 127,622,056 (GRCm39) missense probably benign 0.06
IGL01893:Nphp1 APN 2 127,611,564 (GRCm39) missense probably damaging 1.00
IGL01922:Nphp1 APN 2 127,621,989 (GRCm39) missense possibly damaging 0.95
IGL02123:Nphp1 APN 2 127,595,969 (GRCm39) missense probably benign 0.03
IGL02340:Nphp1 APN 2 127,621,987 (GRCm39) nonsense probably null
IGL02836:Nphp1 APN 2 127,611,543 (GRCm39) missense probably benign 0.00
IGL03109:Nphp1 APN 2 127,610,089 (GRCm39) critical splice donor site probably benign
R1632:Nphp1 UTSW 2 127,612,312 (GRCm39) missense probably benign 0.32
R1857:Nphp1 UTSW 2 127,612,296 (GRCm39) missense probably benign 0.00
R4425:Nphp1 UTSW 2 127,630,719 (GRCm39) missense possibly damaging 0.82
R4514:Nphp1 UTSW 2 127,590,007 (GRCm39) missense probably benign 0.26
R4546:Nphp1 UTSW 2 127,607,939 (GRCm39) splice site probably null
R4580:Nphp1 UTSW 2 127,610,089 (GRCm39) critical splice donor site probably null
R5634:Nphp1 UTSW 2 127,601,570 (GRCm39) missense possibly damaging 0.81
R7152:Nphp1 UTSW 2 127,595,899 (GRCm39) missense probably benign
R7326:Nphp1 UTSW 2 127,603,137 (GRCm39) missense possibly damaging 0.76
R7985:Nphp1 UTSW 2 127,587,829 (GRCm39) missense probably damaging 0.97
R8029:Nphp1 UTSW 2 127,583,036 (GRCm39) missense probably benign 0.00
R8967:Nphp1 UTSW 2 127,582,897 (GRCm39) missense probably damaging 1.00
R8997:Nphp1 UTSW 2 127,595,982 (GRCm39) missense possibly damaging 0.88
R9328:Nphp1 UTSW 2 127,582,892 (GRCm39) missense possibly damaging 0.77
R9450:Nphp1 UTSW 2 127,616,008 (GRCm39) missense
R9755:Nphp1 UTSW 2 127,595,951 (GRCm39) nonsense probably null
X0022:Nphp1 UTSW 2 127,603,134 (GRCm39) missense probably damaging 1.00
X0025:Nphp1 UTSW 2 127,621,047 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TGGGTGCATACGGATATGTG -3'
(R):5'- ATGCTTGTGTAAAATTCTTGGGT -3'

Sequencing Primer
(F):5'- GCATACGGATATGTGTGTATGGAG -3'
(R):5'- AGAGTGAATTGCTACCCCTAGCTG -3'
Posted On 2021-04-30