Mutagenetix > Incidental Mutations

Incidental Mutation 'R7326:Nphp1'

568869

Institutional Source

Beutler Lab

Gene Symbol

Nphp1

Ensembl Gene

ENSMUSG00000027378

Gene Name

nephronophthisis 1 (juvenile) homolog (human)

Synonyms

nephrocystin

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7326 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

127740732-127788897 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 127761217 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 382 (T382I)

Ref Sequence

ENSEMBL: ENSMUSP00000028857 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028857] [ENSMUST00000110357]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028857
AA Change: T382I

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000028857
Gene: ENSMUSG00000027378
AA Change: T382I

Domain	Start	End	E-Value	Type
low complexity region	118	143	N/A	INTRINSIC
SH3	158	214	5.91e-19	SMART
low complexity region	220	246	N/A	INTRINSIC
Blast:14_3_3	391	491	3e-55	BLAST
low complexity region	634	641	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110357
AA Change: T381I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000105986
Gene: ENSMUSG00000027378
AA Change: T381I

Domain	Start	End	E-Value	Type
low complexity region	118	143	N/A	INTRINSIC
SH3	158	214	5.91e-19	SMART
low complexity region	220	246	N/A	INTRINSIC
Blast:14_3_3	390	490	3e-55	BLAST
low complexity region	633	640	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with src homology domain 3 (SH3) patterns. This protein interacts with Crk-associated substrate, and it appears to function in the control of cell division, as well as in cell-cell and cell-matrix adhesion signaling, likely as part of a multifunctional complex localized in actin- and microtubule-based structures. Mutations in this gene cause familial juvenile nephronophthisis type 1, a kidney disorder involving both tubules and glomeruli. Defects in this gene are also associated with Senior-Loken syndrome type 1, also referred to as juvenile nephronophthisis with Leber amaurosis, which is characterized by kidney and eye disease, and with Joubert syndrome type 4, which is characterized by cerebellar ataxia, oculomotor apraxia, psychomotor delay and neonatal breathing abnormalities, sometimes including retinal dystrophy and renal disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male infertility due to defects in sperm maturation. Mice homozygous for another knock-out allele exhibit absent photoreceptor outer segment and photoreceptor degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 112 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430531B16Rik	A	T	7: 139,978,545		probably null	Het
Abcb4	T	C	5: 8,934,226	V652A	probably benign	Het
Acvrl1	G	T	15: 101,141,072	V417L	probably damaging	Het
Add1	A	G	5: 34,619,371	R479G	probably benign	Het
Adgb	A	T	10: 10,400,574	L350Q	possibly damaging	Het
Adgrl2	A	T	3: 148,846,870	S666T	probably benign	Het
Akap9	T	A	5: 4,045,930	D2268E	possibly damaging	Het
Amigo3	C	A	9: 108,054,066	H229Q	probably benign	Het
Ano6	G	C	15: 95,864,244	Q31H	possibly damaging	Het
Ap4m1	G	A	5: 138,175,019	D180N	probably damaging	Het
Apc2	A	T	10: 80,311,740	D876V	probably damaging	Het
Apcdd1	T	A	18: 62,952,188	Y485*	probably null	Het
Aqp1	G	T	6: 55,336,851	D121Y	probably benign	Het
Bicd2	C	A	13: 49,369,609	R141S	probably benign	Het
Brpf3	C	A	17: 28,806,293	H113Q	probably benign	Het
Cacng2	A	T	15: 78,013,320	Y96*	probably null	Het
Catsperg1	G	T	7: 29,210,759	N52K	possibly damaging	Het
Celsr2	A	C	3: 108,394,995	F2606V	possibly damaging	Het
Cerkl	A	T	2: 79,332,605	N516K	probably benign	Het
Ciita	G	A	16: 10,512,288	R812H	probably damaging	Het
Cldn3	T	A	5: 134,986,983	L180Q	probably damaging	Het
Cnot6l	T	C	5: 96,077,299	I512V	probably benign	Het
Col5a2	A	T	1: 45,442,867	D32E	unknown	Het
Coro7	A	G	16: 4,632,048	V616A	probably damaging	Het
Cyp4f18	T	C	8: 71,988,654	D494G	probably benign	Het
Ddx39	T	A	8: 83,722,471	V296E	probably benign	Het
Dgkg	A	T	16: 22,548,690	H593Q	probably damaging	Het
Dhx16	T	C	17: 35,886,160	L645P	probably damaging	Het
Dnah14	A	G	1: 181,598,403	M171V	probably benign	Het
Dnhd1	G	A	7: 105,720,930	V4521I	probably damaging	Het
Dok7	A	T	5: 35,064,522	M60L	probably benign	Het
Donson	A	T	16: 91,688,711	M1K	probably null	Het
Dsp	C	T	13: 38,192,883	T1548M	probably benign	Het
Dyrk1a	A	G	16: 94,692,043	T712A	probably damaging	Het
Eef2	A	G	10: 81,181,282	T708A	probably benign	Het
Epn3	G	A	11: 94,493,780	T289I	probably benign	Het
Fam171a1	C	T	2: 3,226,472	R881*	probably null	Het
Fam71a	G	A	1: 191,164,353	T31M	probably benign	Het
Fat2	T	A	11: 55,282,304	R2528W	probably damaging	Het
Fgfr1	T	G	8: 25,573,839	F707C	probably damaging	Het
Frem2	G	C	3: 53,654,753	P778A	probably damaging	Het
Ganc	A	G	2: 120,430,599	Y255C	probably damaging	Het
Ginm1	A	T	10: 7,777,850	Y65*	probably null	Het
Gm11559	T	A	11: 99,864,881	C119S	unknown	Het
Gnai1	T	A	5: 18,289,551	H188L		Het
H6pd	C	T	4: 149,996,350	A13T	probably benign	Het
Hist1h2be	T	C	13: 23,585,923	K12E	probably benign	Het
Hoxd12	A	T	2: 74,675,246	T54S	possibly damaging	Het
Hs3st5	T	A	10: 36,833,194	L242M	probably damaging	Het
Il9r	C	A	11: 32,194,389	V139L	possibly damaging	Het
Immt	A	G	6: 71,846,369	D68G	probably damaging	Het
Itsn2	A	G	12: 4,632,985	I304V	unknown	Het
Lgr4	G	A	2: 109,996,629	W159*	probably null	Het
Lin52	G	A	12: 84,457,954	G38S	probably damaging	Het
Lpgat1	A	T	1: 191,719,453	M64L	probably benign	Het
Lrrc10b	G	T	19: 10,456,778	R180S	possibly damaging	Het
Lrrc29	T	C	8: 105,312,898	D127G	probably damaging	Het
Lrrc36	A	T	8: 105,449,769	L258F	possibly damaging	Het
Ltbp4	T	A	7: 27,329,755	Q235L	unknown	Het
Maml2	A	G	9: 13,621,607	M706V		Het
Mc5r	G	T	18: 68,339,668	C366F	probably damaging	Het
Mlip	T	C	9: 77,164,842	R244G	probably benign	Het
Muc16	T	A	9: 18,585,013	R6658S	probably benign	Het
Mup4	G	T	4: 59,960,046	H73N	possibly damaging	Het
Nf1	A	G	11: 79,564,943	M565V	probably benign	Het
Nrcam	C	T	12: 44,564,026	T503I	possibly damaging	Het
Nwd2	A	T	5: 63,800,409	N361Y	probably damaging	Het
Olfr1045	A	G	2: 86,198,573	Y60H	probably damaging	Het
Olfr1309	A	T	2: 111,983,327	L249*	probably null	Het
Olfr308	A	G	7: 86,321,574	I126T	probably damaging	Het
Olfr461	G	T	6: 40,544,895	A28E	probably damaging	Het
Olfr518	A	T	7: 108,880,816	H263Q	probably damaging	Het
Olfr836	A	G	9: 19,121,669	Y235C	probably benign	Het
Olfr993	A	T	2: 85,414,444	V145E	probably damaging	Het
Orc5	A	G	5: 22,523,584	F308L	probably benign	Het
Padi1	T	A	4: 140,832,404	Y54F	probably benign	Het
Parp1	A	G	1: 180,569,100	K23E	possibly damaging	Het
Pate1	A	T	9: 35,685,972	V79D	possibly damaging	Het
Pcdh18	T	C	3: 49,756,860	H2R	probably benign	Het
Pcnx2	G	A	8: 125,887,083	S543F	probably damaging	Het
Pcp4l1	G	A	1: 171,174,465	A42V	possibly damaging	Het
Pnkp	T	A	7: 44,859,734	F169L	probably damaging	Het
Ppp6r3	A	T	19: 3,507,325	N254K	probably damaging	Het
Psd	A	G	19: 46,324,454	L159P	probably benign	Het
Ptprf	A	G	4: 118,231,669	Y646H	probably damaging	Het
Rab3ip	A	T	10: 116,937,633	S92T	probably benign	Het
Rabgef1	A	G	5: 130,187,351		probably benign	Het
Ralgapa1	C	A	12: 55,709,004	W1129L	probably damaging	Het
Rhpn2	T	A	7: 35,385,463	L594Q	probably benign	Het
Rnf38	C	A	4: 44,158,989		probably benign	Het
Ryr2	T	A	13: 11,738,194	H1747L	possibly damaging	Het
Sec16a	A	G	2: 26,439,717	L13P	unknown	Het
Sppl3	C	A	5: 115,082,335	T102K	probably damaging	Het
Srgap2	A	T	1: 131,291,613	Y264*	probably null	Het
Stxbp2	T	C	8: 3,641,151	M465T		Het
Sumf2	A	G	5: 129,862,710	K305R	probably benign	Het
Susd2	T	A	10: 75,642,565	Y59F	probably benign	Het
Taco1	T	C	11: 106,072,617	V198A	probably benign	Het
Tas2r136	A	T	6: 132,777,906	M86K	possibly damaging	Het
Tbc1d10c	T	C	19: 4,184,898	E388G	possibly damaging	Het
Tmem132c	C	T	5: 127,564,059	T1098I	possibly damaging	Het
Trim3	G	T	7: 105,617,800	Y457*	probably null	Het
Ttc38	A	G	15: 85,852,861	T316A	probably benign	Het
Ubqln4	T	A	3: 88,555,910	N127K	probably benign	Het
Wdr91	A	T	6: 34,904,626	F262Y	probably damaging	Het
Zdhhc6	A	T	19: 55,302,755	C343S	possibly damaging	Het
Zfp248	A	G	6: 118,430,209	C140R	probably damaging	Het
Zfp266	T	C	9: 20,502,095	T90A	probably benign	Het
Zfp407	A	T	18: 84,559,042	D1315E	possibly damaging	Het
Zfp644	T	C	5: 106,638,277	S135G	probably benign	Het
Zscan29	A	T	2: 121,160,988	I773N	probably damaging	Het
Zswim5	T	A	4: 116,980,834	V787E	possibly damaging	Het

Other mutations in Nphp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00570:Nphp1	APN	2	127763885	missense	probably damaging	0.99
IGL00589:Nphp1	APN	2	127763849	missense	probably damaging	1.00
IGL01143:Nphp1	APN	2	127780136	missense	probably benign	0.06
IGL01893:Nphp1	APN	2	127769644	missense	probably damaging	1.00
IGL01922:Nphp1	APN	2	127780069	missense	possibly damaging	0.95
IGL02123:Nphp1	APN	2	127754049	missense	probably benign	0.03
IGL02340:Nphp1	APN	2	127780067	nonsense	probably null
IGL02836:Nphp1	APN	2	127769623	missense	probably benign	0.00
IGL03109:Nphp1	APN	2	127768169	critical splice donor site	probably benign
R1632:Nphp1	UTSW	2	127770392	missense	probably benign	0.32
R1857:Nphp1	UTSW	2	127770376	missense	probably benign	0.00
R4425:Nphp1	UTSW	2	127788799	missense	possibly damaging	0.82
R4514:Nphp1	UTSW	2	127748087	missense	probably benign	0.26
R4546:Nphp1	UTSW	2	127766019	splice site	probably null
R4580:Nphp1	UTSW	2	127768169	critical splice donor site	probably null
R5634:Nphp1	UTSW	2	127759650	missense	possibly damaging	0.81
R7152:Nphp1	UTSW	2	127753979	missense	probably benign
R7985:Nphp1	UTSW	2	127745909	missense	probably damaging	0.97
R8029:Nphp1	UTSW	2	127741116	missense	probably benign	0.00
X0022:Nphp1	UTSW	2	127761214	missense	probably damaging	1.00
X0025:Nphp1	UTSW	2	127779127	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- TTCAGTGAGTCAGGGACCTG -3'
(R):5'- TGTGCTCAACATGTGCTCTGC -3'

Sequencing Primer
(F):5'- TTGCCCTAAACACTGCAC -3'
(R):5'- CCCCTACAATGTGGTTTC -3'

Posted On

2019-09-13