Incidental Mutation 'R8795:Usp15'
ID 671208
Institutional Source Beutler Lab
Gene Symbol Usp15
Ensembl Gene ENSMUSG00000020124
Gene Name ubiquitin specific peptidase 15
Synonyms Gcap18, 4921514G19Rik, E430033I05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8795 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 123105006-123196995 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 123153048 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 255 (N255Y)
Ref Sequence ENSEMBL: ENSMUSP00000151244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020334] [ENSMUST00000220377]
AlphaFold Q8R5H1
Predicted Effect probably benign
Transcript: ENSMUST00000020334
SMART Domains Protein: ENSMUSP00000020334
Gene: ENSMUSG00000020124

DomainStartEndE-ValueType
DUSP 23 121 1.5e-46 SMART
Pfam:Ubiquitin_3 135 222 3.7e-38 PFAM
low complexity region 242 262 N/A INTRINSIC
Pfam:UCH 288 930 6.8e-86 PFAM
Pfam:UCH_1 289 506 1.1e-5 PFAM
Pfam:USP7_C2 460 608 2e-7 PFAM
Pfam:UCH_1 756 912 1.3e-11 PFAM
low complexity region 959 976 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220377
AA Change: N255Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the large ubiquitin specific protease (Usp) family of proteins. These proteins are known to cleave ubiquitin, and contain a conserved cysteine residue (Cys box) and two conserved histidine residues (His box) that are thought to form part of the active site of the protease. This protein has been shown to cleave both the ubiquitin-proline and the ubiquitin-methionine bonds in vitro. This protein is thought to regulate many cellular processes through its deubiquitination activity, including the transforming growth factor beta (TGF-beta) pathway. Cardiac-specific overexpression of the human ortholog of this gene in mice causes enlargement of the heart that is more pronounced in the atrium than in the ventricle. This gene has two pseudogenes on chromosome 14. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms.[provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a knock-out allele or ENU induced allele exhibit resistance to pathological neuroinflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A T 17: 45,507,672 M128L probably damaging Het
Abcc12 A G 8: 86,531,584 S768P possibly damaging Het
Adamts8 A T 9: 30,943,188 M118L probably benign Het
Adgrl4 A G 3: 151,510,779 N533S probably benign Het
Agk T G 6: 40,386,920 I278R possibly damaging Het
Atr T A 9: 95,867,531 W466R probably damaging Het
Cacna1h C T 17: 25,393,564 V387I probably damaging Het
Cand2 T G 6: 115,786,928 D270E probably benign Het
Ccdc107 C T 4: 43,495,514 T139M probably damaging Het
Cenpl A G 1: 161,083,014 E177G probably benign Het
Clint1 C A 11: 45,884,351 Q56K probably damaging Het
Col9a1 A G 1: 24,194,731 R249G unknown Het
Cpne5 C T 17: 29,204,688 probably benign Het
Ddx27 A G 2: 167,017,810 D54G probably benign Het
Dync2h1 C T 9: 7,137,087 E1468K probably benign Het
E130308A19Rik A T 4: 59,737,676 N429I possibly damaging Het
Endov G T 11: 119,499,554 G86C possibly damaging Het
Ercc5 A T 1: 44,163,929 Y242F possibly damaging Het
Gabrr1 T A 4: 33,161,756 V360E probably damaging Het
Gcn1l1 T C 5: 115,614,395 I2153T probably benign Het
Gje1 T C 10: 14,718,126 N8S probably benign Het
Gm12394 A G 4: 42,792,992 V380A probably benign Het
Greb1l A G 18: 10,553,739 H1580R probably damaging Het
Grin1 C G 2: 25,297,456 S614T probably damaging Het
Hmcn2 A G 2: 31,425,381 N3714S probably benign Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Ifitm2 A T 7: 140,955,748 H56Q probably damaging Het
Ifrd1 G A 12: 40,213,077 T218I possibly damaging Het
Igkv1-99 G T 6: 68,542,386 G109V Het
Impg2 A G 16: 56,260,248 E805G probably benign Het
Itgb6 T A 2: 60,653,285 N260Y probably damaging Het
Maneal G T 4: 124,856,690 Y424* probably null Het
Map4k2 T G 19: 6,351,610 C677W probably damaging Het
Med6 T C 12: 81,591,260 H59R probably benign Het
Mms22l T A 4: 24,536,245 D571E probably benign Het
Mroh8 A G 2: 157,225,573 F622S probably damaging Het
Mrpl44 A T 1: 79,776,257 Q42L probably damaging Het
Myh8 G T 11: 67,283,377 probably benign Het
Ndufb2 T C 6: 39,592,652 V13A probably benign Het
Nf1 T A 11: 79,425,616 L499Q probably damaging Het
Olfr1185-ps1 T G 2: 88,499,511 V142G probably damaging Het
Olfr1281 T A 2: 111,328,536 L39* probably null Het
Olfr1357 T C 10: 78,611,864 Y259C probably damaging Het
Olfr782 T C 10: 129,351,325 I254T probably damaging Het
Opa1 T C 16: 29,629,632 C874R probably damaging Het
Pld3 T A 7: 27,535,861 D314V possibly damaging Het
Pou6f1 A C 15: 100,587,805 C114W possibly damaging Het
Pqlc3 A G 12: 16,993,480 W150R probably damaging Het
Prl2c1 A C 13: 27,849,406 Q2P possibly damaging Het
Prl2c1 G T 13: 27,849,407 Q2H probably benign Het
Pzp C A 6: 128,494,738 K908N probably damaging Het
Rab6b G A 9: 103,162,626 G125D probably damaging Het
Rhbdd2 C T 5: 135,635,131 T69I probably benign Het
Samd9l A T 6: 3,374,221 Y1013* probably null Het
Slc13a4 T A 6: 35,283,295 T217S probably benign Het
Smarcad1 T C 6: 65,072,049 L253S probably benign Het
Snrpa C A 7: 27,191,609 V146L possibly damaging Het
Srrt A T 5: 137,299,976 D311E probably benign Het
Stk32b A T 5: 37,649,139 F20L probably damaging Het
Sult2a7 T C 7: 14,490,089 T136A probably benign Het
Sv2a G A 3: 96,187,080 V244I probably benign Het
Tesk1 T A 4: 43,446,070 probably null Het
Tmem260 A G 14: 48,451,913 H63R probably damaging Het
Ugt1a6b A G 1: 88,107,072 E44G probably benign Het
Unc79 A T 12: 103,108,254 I1363F probably damaging Het
Usp35 A G 7: 97,311,960 V753A possibly damaging Het
Usp35 T C 7: 97,312,063 N719D probably benign Het
Vmn2r104 T A 17: 20,042,726 I158L probably benign Het
Vmn2r69 A T 7: 85,415,675 M1K probably null Het
Zan C T 5: 137,398,260 E4345K unknown Het
Zc3h7a A T 16: 11,147,283 M662K possibly damaging Het
Zfp512 G A 5: 31,476,790 V438M probably damaging Het
Zfy1 T C Y: 738,945 D87G unknown Het
Zmym4 A T 4: 126,906,026 V653E probably benign Het
Other mutations in Usp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Usp15 APN 10 123113596 missense probably benign 0.00
IGL02148:Usp15 APN 10 123127837 missense probably damaging 1.00
IGL02737:Usp15 APN 10 123131032 missense probably damaging 1.00
IGL03054:Usp15 APN 10 123125931 splice site probably benign
IGL03163:Usp15 APN 10 123171144 missense probably damaging 0.96
R1755:Usp15 UTSW 10 123133044 missense probably damaging 0.98
R1981:Usp15 UTSW 10 123125041 splice site probably benign
R2049:Usp15 UTSW 10 123119137 missense probably damaging 1.00
R3037:Usp15 UTSW 10 123163617 missense probably damaging 1.00
R3698:Usp15 UTSW 10 123181738 missense probably damaging 1.00
R3828:Usp15 UTSW 10 123196870 missense possibly damaging 0.95
R3845:Usp15 UTSW 10 123119135 missense probably damaging 1.00
R4838:Usp15 UTSW 10 123127757 missense probably damaging 0.99
R4954:Usp15 UTSW 10 123131398 missense probably damaging 1.00
R5204:Usp15 UTSW 10 123113640 missense probably benign 0.06
R5274:Usp15 UTSW 10 123168351 missense probably damaging 1.00
R5387:Usp15 UTSW 10 123131286 missense probably damaging 0.96
R5474:Usp15 UTSW 10 123128045 missense probably damaging 1.00
R5501:Usp15 UTSW 10 123175899 missense probably damaging 0.99
R5665:Usp15 UTSW 10 123130987 nonsense probably null
R5846:Usp15 UTSW 10 123181742 missense probably damaging 1.00
R5850:Usp15 UTSW 10 123124512 critical splice donor site probably null
R6163:Usp15 UTSW 10 123168305 missense probably damaging 1.00
R6735:Usp15 UTSW 10 123168367 missense possibly damaging 0.86
R6828:Usp15 UTSW 10 123127989 missense probably damaging 1.00
R7170:Usp15 UTSW 10 123171195 missense probably damaging 1.00
R7197:Usp15 UTSW 10 123131005 missense possibly damaging 0.92
R7351:Usp15 UTSW 10 123132999 missense probably damaging 1.00
R7368:Usp15 UTSW 10 123196893 missense possibly damaging 0.86
R7447:Usp15 UTSW 10 123175881 missense probably damaging 1.00
R8099:Usp15 UTSW 10 123146921 missense possibly damaging 0.87
R8169:Usp15 UTSW 10 123125893 missense
R8316:Usp15 UTSW 10 123123943 missense
R9005:Usp15 UTSW 10 123146798 missense possibly damaging 0.89
R9023:Usp15 UTSW 10 123125593 missense possibly damaging 0.85
R9156:Usp15 UTSW 10 123113648 missense probably benign 0.13
R9198:Usp15 UTSW 10 123168238 missense probably damaging 1.00
R9278:Usp15 UTSW 10 123171207 missense probably damaging 0.96
Z1176:Usp15 UTSW 10 123196961 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CGACACAGGAGAGCTGTATTTG -3'
(R):5'- TACCCTGAGAAGTGGTATGTTG -3'

Sequencing Primer
(F):5'- ACACAGGAGAGCTGTATTTGTCTTTG -3'
(R):5'- CCCTGAGAAGTGGTATGTTGAGTTAG -3'
Posted On 2021-04-30