Mutagenetix > Incidental Mutations

Incidental Mutation 'R8795:Usp15'

671208

Institutional Source

Beutler Lab

Gene Symbol

Usp15

Ensembl Gene

ENSMUSG00000020124

Gene Name

ubiquitin specific peptidase 15

Synonyms

Gcap18, 4921514G19Rik, E430033I05Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8795 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

123105006-123196995 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 123153048 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 255 (N255Y)

Ref Sequence

ENSEMBL: ENSMUSP00000151244 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020334] [ENSMUST00000220377]

AlphaFold

Q8R5H1

Predicted Effect

probably benign
Transcript: ENSMUST00000020334

SMART Domains

Protein: ENSMUSP00000020334
Gene: ENSMUSG00000020124

Domain	Start	End	E-Value	Type
DUSP	23	121	1.5e-46	SMART
Pfam:Ubiquitin_3	135	222	3.7e-38	PFAM
low complexity region	242	262	N/A	INTRINSIC
Pfam:UCH	288	930	6.8e-86	PFAM
Pfam:UCH_1	289	506	1.1e-5	PFAM
Pfam:USP7_C2	460	608	2e-7	PFAM
Pfam:UCH_1	756	912	1.3e-11	PFAM
low complexity region	959	976	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000220377
AA Change: N255Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

97% (72/74)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the large ubiquitin specific protease (Usp) family of proteins. These proteins are known to cleave ubiquitin, and contain a conserved cysteine residue (Cys box) and two conserved histidine residues (His box) that are thought to form part of the active site of the protease. This protein has been shown to cleave both the ubiquitin-proline and the ubiquitin-methionine bonds in vitro. This protein is thought to regulate many cellular processes through its deubiquitination activity, including the transforming growth factor beta (TGF-beta) pathway. Cardiac-specific overexpression of the human ortholog of this gene in mice causes enlargement of the heart that is more pronounced in the atrium than in the ventricle. This gene has two pseudogenes on chromosome 14. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms.[provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a knock-out allele or ENU induced allele exhibit resistance to pathological neuroinflammation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	A	T	17: 45,507,672	M128L	probably damaging	Het
Abcc12	A	G	8: 86,531,584	S768P	possibly damaging	Het
Adamts8	A	T	9: 30,943,188	M118L	probably benign	Het
Adgrl4	A	G	3: 151,510,779	N533S	probably benign	Het
Agk	T	G	6: 40,386,920	I278R	possibly damaging	Het
Atr	T	A	9: 95,867,531	W466R	probably damaging	Het
Cacna1h	C	T	17: 25,393,564	V387I	probably damaging	Het
Cand2	T	G	6: 115,786,928	D270E	probably benign	Het
Ccdc107	C	T	4: 43,495,514	T139M	probably damaging	Het
Cenpl	A	G	1: 161,083,014	E177G	probably benign	Het
Clint1	C	A	11: 45,884,351	Q56K	probably damaging	Het
Col9a1	A	G	1: 24,194,731	R249G	unknown	Het
Cpne5	C	T	17: 29,204,688		probably benign	Het
Ddx27	A	G	2: 167,017,810	D54G	probably benign	Het
Dync2h1	C	T	9: 7,137,087	E1468K	probably benign	Het
E130308A19Rik	A	T	4: 59,737,676	N429I	possibly damaging	Het
Endov	G	T	11: 119,499,554	G86C	possibly damaging	Het
Ercc5	A	T	1: 44,163,929	Y242F	possibly damaging	Het
Gabrr1	T	A	4: 33,161,756	V360E	probably damaging	Het
Gcn1l1	T	C	5: 115,614,395	I2153T	probably benign	Het
Gje1	T	C	10: 14,718,126	N8S	probably benign	Het
Gm12394	A	G	4: 42,792,992	V380A	probably benign	Het
Greb1l	A	G	18: 10,553,739	H1580R	probably damaging	Het
Grin1	C	G	2: 25,297,456	S614T	probably damaging	Het
Hmcn2	A	G	2: 31,425,381	N3714S	probably benign	Het
Idh1	CA	CAA	1: 65,165,188		probably null	Het
Ifitm2	A	T	7: 140,955,748	H56Q	probably damaging	Het
Ifrd1	G	A	12: 40,213,077	T218I	possibly damaging	Het
Igkv1-99	G	T	6: 68,542,386	G109V		Het
Impg2	A	G	16: 56,260,248	E805G	probably benign	Het
Itgb6	T	A	2: 60,653,285	N260Y	probably damaging	Het
Maneal	G	T	4: 124,856,690	Y424*	probably null	Het
Map4k2	T	G	19: 6,351,610	C677W	probably damaging	Het
Med6	T	C	12: 81,591,260	H59R	probably benign	Het
Mms22l	T	A	4: 24,536,245	D571E	probably benign	Het
Mroh8	A	G	2: 157,225,573	F622S	probably damaging	Het
Mrpl44	A	T	1: 79,776,257	Q42L	probably damaging	Het
Myh8	G	T	11: 67,283,377		probably benign	Het
Ndufb2	T	C	6: 39,592,652	V13A	probably benign	Het
Nf1	T	A	11: 79,425,616	L499Q	probably damaging	Het
Olfr1185-ps1	T	G	2: 88,499,511	V142G	probably damaging	Het
Olfr1281	T	A	2: 111,328,536	L39*	probably null	Het
Olfr1357	T	C	10: 78,611,864	Y259C	probably damaging	Het
Olfr782	T	C	10: 129,351,325	I254T	probably damaging	Het
Opa1	T	C	16: 29,629,632	C874R	probably damaging	Het
Pld3	T	A	7: 27,535,861	D314V	possibly damaging	Het
Pou6f1	A	C	15: 100,587,805	C114W	possibly damaging	Het
Pqlc3	A	G	12: 16,993,480	W150R	probably damaging	Het
Prl2c1	A	C	13: 27,849,406	Q2P	possibly damaging	Het
Prl2c1	G	T	13: 27,849,407	Q2H	probably benign	Het
Pzp	C	A	6: 128,494,738	K908N	probably damaging	Het
Rab6b	G	A	9: 103,162,626	G125D	probably damaging	Het
Rhbdd2	C	T	5: 135,635,131	T69I	probably benign	Het
Samd9l	A	T	6: 3,374,221	Y1013*	probably null	Het
Slc13a4	T	A	6: 35,283,295	T217S	probably benign	Het
Smarcad1	T	C	6: 65,072,049	L253S	probably benign	Het
Snrpa	C	A	7: 27,191,609	V146L	possibly damaging	Het
Srrt	A	T	5: 137,299,976	D311E	probably benign	Het
Stk32b	A	T	5: 37,649,139	F20L	probably damaging	Het
Sult2a7	T	C	7: 14,490,089	T136A	probably benign	Het
Sv2a	G	A	3: 96,187,080	V244I	probably benign	Het
Tesk1	T	A	4: 43,446,070		probably null	Het
Tmem260	A	G	14: 48,451,913	H63R	probably damaging	Het
Ugt1a6b	A	G	1: 88,107,072	E44G	probably benign	Het
Unc79	A	T	12: 103,108,254	I1363F	probably damaging	Het
Usp35	A	G	7: 97,311,960	V753A	possibly damaging	Het
Usp35	T	C	7: 97,312,063	N719D	probably benign	Het
Vmn2r104	T	A	17: 20,042,726	I158L	probably benign	Het
Vmn2r69	A	T	7: 85,415,675	M1K	probably null	Het
Zan	C	T	5: 137,398,260	E4345K	unknown	Het
Zc3h7a	A	T	16: 11,147,283	M662K	possibly damaging	Het
Zfp512	G	A	5: 31,476,790	V438M	probably damaging	Het
Zfy1	T	C	Y: 738,945	D87G	unknown	Het
Zmym4	A	T	4: 126,906,026	V653E	probably benign	Het

Other mutations in Usp15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Usp15	APN	10	123113596	missense	probably benign	0.00
IGL02148:Usp15	APN	10	123127837	missense	probably damaging	1.00
IGL02737:Usp15	APN	10	123131032	missense	probably damaging	1.00
IGL03054:Usp15	APN	10	123125931	splice site	probably benign
IGL03163:Usp15	APN	10	123171144	missense	probably damaging	0.96
R1755:Usp15	UTSW	10	123133044	missense	probably damaging	0.98
R1981:Usp15	UTSW	10	123125041	splice site	probably benign
R2049:Usp15	UTSW	10	123119137	missense	probably damaging	1.00
R3037:Usp15	UTSW	10	123163617	missense	probably damaging	1.00
R3698:Usp15	UTSW	10	123181738	missense	probably damaging	1.00
R3828:Usp15	UTSW	10	123196870	missense	possibly damaging	0.95
R3845:Usp15	UTSW	10	123119135	missense	probably damaging	1.00
R4838:Usp15	UTSW	10	123127757	missense	probably damaging	0.99
R4954:Usp15	UTSW	10	123131398	missense	probably damaging	1.00
R5204:Usp15	UTSW	10	123113640	missense	probably benign	0.06
R5274:Usp15	UTSW	10	123168351	missense	probably damaging	1.00
R5387:Usp15	UTSW	10	123131286	missense	probably damaging	0.96
R5474:Usp15	UTSW	10	123128045	missense	probably damaging	1.00
R5501:Usp15	UTSW	10	123175899	missense	probably damaging	0.99
R5665:Usp15	UTSW	10	123130987	nonsense	probably null
R5846:Usp15	UTSW	10	123181742	missense	probably damaging	1.00
R5850:Usp15	UTSW	10	123124512	critical splice donor site	probably null
R6163:Usp15	UTSW	10	123168305	missense	probably damaging	1.00
R6735:Usp15	UTSW	10	123168367	missense	possibly damaging	0.86
R6828:Usp15	UTSW	10	123127989	missense	probably damaging	1.00
R7170:Usp15	UTSW	10	123171195	missense	probably damaging	1.00
R7197:Usp15	UTSW	10	123131005	missense	possibly damaging	0.92
R7351:Usp15	UTSW	10	123132999	missense	probably damaging	1.00
R7368:Usp15	UTSW	10	123196893	missense	possibly damaging	0.86
R7447:Usp15	UTSW	10	123175881	missense	probably damaging	1.00
R8099:Usp15	UTSW	10	123146921	missense	possibly damaging	0.87
R8169:Usp15	UTSW	10	123125893	missense
R8316:Usp15	UTSW	10	123123943	missense
R9005:Usp15	UTSW	10	123146798	missense	possibly damaging	0.89
R9023:Usp15	UTSW	10	123125593	missense	possibly damaging	0.85
R9156:Usp15	UTSW	10	123113648	missense	probably benign	0.13
R9198:Usp15	UTSW	10	123168238	missense	probably damaging	1.00
R9278:Usp15	UTSW	10	123171207	missense	probably damaging	0.96
Z1176:Usp15	UTSW	10	123196961	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- CGACACAGGAGAGCTGTATTTG -3'
(R):5'- TACCCTGAGAAGTGGTATGTTG -3'

Sequencing Primer
(F):5'- ACACAGGAGAGCTGTATTTGTCTTTG -3'
(R):5'- CCCTGAGAAGTGGTATGTTGAGTTAG -3'

Posted On

2021-04-30