Incidental Mutation 'R8539:Galnt13'
ID673227
Institutional Source Beutler Lab
Gene Symbol Galnt13
Ensembl Gene ENSMUSG00000060988
Gene Namepolypeptide N-acetylgalactosaminyltransferase 13
Synonymspp-GalNAc-T13
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R8539 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location54436317-55118309 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to T at 54933572 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068595] [ENSMUST00000112634] [ENSMUST00000112635] [ENSMUST00000112636]
Predicted Effect probably null
Transcript: ENSMUST00000068595
SMART Domains Protein: ENSMUSP00000063464
Gene: ENSMUSG00000060988

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 368 1.5e-11 PFAM
Pfam:Glycos_transf_2 118 302 7.4e-35 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.1e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.8e-9 PFAM
RICIN 427 550 9.63e-34 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112634
SMART Domains Protein: ENSMUSP00000108253
Gene: ENSMUSG00000060988

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 367 2.7e-10 PFAM
Pfam:Glycos_transf_2 118 302 1.8e-38 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.2e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.9e-10 PFAM
RICIN 427 586 5.34e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112635
SMART Domains Protein: ENSMUSP00000108254
Gene: ENSMUSG00000060988

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 368 1.5e-11 PFAM
Pfam:Glycos_transf_2 118 302 7.4e-35 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.1e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.8e-9 PFAM
RICIN 427 550 9.63e-34 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112636
SMART Domains Protein: ENSMUSP00000108255
Gene: ENSMUSG00000060988

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 368 1.5e-11 PFAM
Pfam:Glycos_transf_2 118 302 7.4e-35 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.1e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.8e-9 PFAM
RICIN 427 550 9.63e-34 SMART
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The GALNT13 protein is a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAcT; EC 2.4.1.41) family, which initiate O-linked glycosylation of mucins (see MUC3A, MIM 158371) by the initial transfer of N-acetylgalactosamine (GalNAc) with an alpha-linkage to a serine or threonine residue.[supplied by OMIM, Apr 2004]
PHENOTYPE: Galnt13 is expressed exclusively in neuronal cells. Conditional animals can be used with cre-expressing strains to produce total or tissue-specific deletion of this locus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c6 G A 13: 4,434,475 probably null Het
Amz1 T C 5: 140,748,657 L215S probably benign Het
Aplnr A G 2: 85,136,907 D92G probably benign Het
Arpc5 A G 1: 152,766,801 D26G probably damaging Het
Cntrob G A 11: 69,320,826 R191C possibly damaging Het
Ephb4 A G 5: 137,357,855 D242G probably damaging Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Hcrt T A 11: 100,761,225 probably benign Het
Hnf1a A G 5: 114,970,517 probably null Het
Hykk A G 9: 54,937,160 S170G probably benign Het
Igf1r C A 7: 68,003,848 Q45K probably benign Het
Klhl8 C T 5: 103,867,526 V511I probably damaging Het
Loxl3 A T 6: 83,049,526 M488L probably benign Het
Myo7a G A 7: 98,072,461 P1221S probably damaging Het
Myom2 A T 8: 15,114,254 I1050F probably benign Het
Ncapd3 T G 9: 27,048,224 C319G probably benign Het
Ndufaf5 C A 2: 140,183,974 T151K possibly damaging Het
Notch3 A T 17: 32,156,355 D364E possibly damaging Het
Nudt21 G A 8: 94,036,973 probably benign Het
Olfr1370 T C 13: 21,073,173 I43V probably benign Het
Pkd1l3 T A 8: 109,636,287 V1060E probably damaging Het
Plxnd1 G C 6: 115,962,807 P1404A possibly damaging Het
Ret A G 6: 118,175,809 V523A possibly damaging Het
Ror1 T C 4: 100,441,887 I819T possibly damaging Het
Scn10a T A 9: 119,638,774 K767* probably null Het
Sema5a T A 15: 32,618,843 W506R probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Sult1b1 C A 5: 87,533,979 V67F possibly damaging Het
Suz12 T A 11: 79,999,078 D13E probably damaging Het
Tap1 C T 17: 34,189,435 A216V probably benign Het
Tlr3 A G 8: 45,398,516 L448P probably damaging Het
Tnik G A 3: 28,542,003 V182M probably damaging Het
Ttn A G 2: 76,906,434 F4329L probably benign Het
Usp21 C T 1: 171,283,673 E396K probably damaging Het
Vmn1r122 A T 7: 21,133,356 I258N possibly damaging Het
Vmn2r106 C A 17: 20,279,009 R213S probably benign Het
Vmn2r111 A T 17: 22,571,293 M244K probably benign Het
Zeb1 T A 18: 5,748,784 V117D probably damaging Het
Other mutations in Galnt13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Galnt13 APN 2 54516535 utr 5 prime probably benign
IGL00769:Galnt13 APN 2 54880104 missense probably benign 0.37
IGL01533:Galnt13 APN 2 54880132 missense probably damaging 1.00
IGL01862:Galnt13 APN 2 54857914 missense probably damaging 1.00
IGL02363:Galnt13 APN 2 55112860 missense probably damaging 1.00
IGL02493:Galnt13 APN 2 54880137 missense probably benign 0.05
IGL03108:Galnt13 APN 2 54854648 missense probably benign 0.02
IGL03219:Galnt13 APN 2 54933435 missense possibly damaging 0.85
G1patch:Galnt13 UTSW 2 54855232 missense probably damaging 1.00
R0142:Galnt13 UTSW 2 55098603 missense probably damaging 1.00
R0324:Galnt13 UTSW 2 54854616 missense probably benign 0.01
R0379:Galnt13 UTSW 2 55060492 missense possibly damaging 0.72
R1321:Galnt13 UTSW 2 55098594 missense probably damaging 0.98
R1509:Galnt13 UTSW 2 54733082 missense probably damaging 1.00
R1521:Galnt13 UTSW 2 54854645 missense probably benign
R1539:Galnt13 UTSW 2 54857857 missense probably damaging 1.00
R1638:Galnt13 UTSW 2 54854655 missense probably damaging 1.00
R1640:Galnt13 UTSW 2 55060546 missense probably damaging 1.00
R2299:Galnt13 UTSW 2 55060583 missense possibly damaging 0.61
R2365:Galnt13 UTSW 2 54854697 missense possibly damaging 0.85
R2367:Galnt13 UTSW 2 55112944 missense probably benign 0.00
R3687:Galnt13 UTSW 2 54880062 missense probably benign 0.31
R3726:Galnt13 UTSW 2 55098657 missense probably damaging 1.00
R3730:Galnt13 UTSW 2 54933507 missense possibly damaging 0.91
R3731:Galnt13 UTSW 2 54933507 missense possibly damaging 0.91
R4626:Galnt13 UTSW 2 54857866 missense probably damaging 1.00
R4880:Galnt13 UTSW 2 55060572 missense probably damaging 1.00
R4928:Galnt13 UTSW 2 54516565 missense probably damaging 1.00
R5421:Galnt13 UTSW 2 54857896 missense probably damaging 1.00
R6136:Galnt13 UTSW 2 54516479 start gained probably benign
R6244:Galnt13 UTSW 2 54933548 missense probably damaging 1.00
R6725:Galnt13 UTSW 2 54855232 missense probably damaging 1.00
R7058:Galnt13 UTSW 2 55098575 missense probably damaging 0.99
R7448:Galnt13 UTSW 2 54516564 missense possibly damaging 0.94
R7635:Galnt13 UTSW 2 54857817 missense probably damaging 1.00
R7889:Galnt13 UTSW 2 55112861 missense probably benign 0.02
R8003:Galnt13 UTSW 2 55060485 nonsense probably null
R8207:Galnt13 UTSW 2 54880110 missense probably benign 0.00
R8525:Galnt13 UTSW 2 55060476 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATCTGGCAATGTGGAGGTTC -3'
(R):5'- AAAGCCCCGATGTTCATGCTTC -3'

Sequencing Primer
(F):5'- CTTTGGAGATTGTGACTTGCTCTC -3'
(R):5'- GAGGATGCAAAAATGTTTCATTGG -3'
Posted On2021-05-20