Incidental Mutation 'R8831:Slc19a2'
ID673798
Institutional Source Beutler Lab
Gene Symbol Slc19a2
Ensembl Gene ENSMUSG00000040918
Gene Namesolute carrier family 19 (thiamine transporter), member 2
SynonymsTRMA, DDA1, THTR1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R8831 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location164249046-164265385 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 164256874 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 111 (T111M)
Ref Sequence ENSEMBL: ENSMUSP00000037561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044021] [ENSMUST00000159230] [ENSMUST00000169394]
AlphaFold Q9EQN9
Predicted Effect probably damaging
Transcript: ENSMUST00000044021
AA Change: T111M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037561
Gene: ENSMUSG00000040918
AA Change: T111M

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
Pfam:Folate_carrier 28 459 2.7e-180 PFAM
Pfam:MFS_1 34 441 2.6e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159230
AA Change: T111M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123870
Gene: ENSMUSG00000040918
AA Change: T111M

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
Pfam:Folate_carrier 28 421 1.6e-176 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169394
SMART Domains Protein: ENSMUSP00000131327
Gene: ENSMUSG00000040918

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
Pfam:Folate_carrier 28 70 3.7e-17 PFAM
Pfam:Folate_carrier 65 258 6.7e-85 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the thiamin transporter protein. Mutations in this gene cause thiamin-responsive megaloblastic anemia syndrome (TRMA), which is an autosomal recessive disorder characterized by diabetes mellitus, megaloblastic anemia and sensorineural deafness. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygotes for targeted null alleles exhibit a grossly normal phenotype except for reduced testis size and male infertility. On a low-thiamine diet, mutants show premature death and sensorineural deafness, while homozygotes for one targeted allele also display diabetes mellitus and megaloblastosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,182,136 I320T probably benign Het
5430403G16Rik A T 5: 109,676,308 S425R probably benign Het
A230072I06Rik A T 8: 12,279,688 I48L unknown Het
Abcc3 A C 11: 94,350,961 C1415G probably damaging Het
Abcf3 C T 16: 20,550,464 R205C probably damaging Het
Abcg5 G T 17: 84,668,995 H471Q probably damaging Het
Actl6b G A 5: 137,567,043 R363Q probably damaging Het
Adcy1 T A 11: 7,161,362 D884E probably benign Het
Aldh3a1 A G 11: 61,216,316 Y282C probably damaging Het
Amdhd2 A G 17: 24,157,738 probably null Het
Arfgef3 A G 10: 18,652,743 S299P possibly damaging Het
Asic2 A T 11: 81,967,900 N95K probably damaging Het
Atp2c2 A G 8: 119,749,294 probably null Het
Atrn T C 2: 130,906,601 L14P probably benign Het
BC027072 A T 17: 71,752,310 V124E probably benign Het
C8b A G 4: 104,790,677 Y355C probably damaging Het
Carm1 A G 9: 21,580,367 E244G probably damaging Het
Cish T A 9: 107,300,472 F116I probably damaging Het
Clstn1 G A 4: 149,646,323 R837Q probably benign Het
Cox10 A G 11: 63,964,480 F325S probably damaging Het
Ctps A T 4: 120,567,310 S36T possibly damaging Het
Dchs2 T C 3: 83,285,363 L1705P probably benign Het
Defb25 C A 2: 152,622,979 V17L probably benign Het
Dhx16 A G 17: 35,888,108 D782G probably damaging Het
Dhx30 A G 9: 110,088,251 S399P probably benign Het
Dhx58 T A 11: 100,703,980 K30M probably damaging Het
Drc7 G A 8: 95,062,217 R301Q probably damaging Het
Dsg1a T C 18: 20,320,308 V21A probably damaging Het
Ercc6 T A 14: 32,560,827 probably null Het
Fam193a A G 5: 34,459,030 T850A probably benign Het
Fgf10 A G 13: 118,789,135 D150G probably damaging Het
Flii A T 11: 60,725,248 N28K probably benign Het
Gfi1 G A 5: 107,720,272 R377C probably damaging Het
Gfra2 A T 14: 70,967,063 N324I probably benign Het
Gm10308 A G 17: 91,089,003 R118G unknown Het
Gm10801 T A 2: 98,663,989 V137E probably damaging Het
Gm4450 A T 3: 98,446,731 W151R probably benign Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Ift80 G A 3: 68,962,250 A236V probably damaging Het
Il1rn A T 2: 24,349,493 T134S possibly damaging Het
Il6st G T 13: 112,504,380 D897Y probably damaging Het
Imp4 T C 1: 34,444,364 M257T probably benign Het
Impdh2 T C 9: 108,564,758 L377S probably damaging Het
Kdm1b C A 13: 47,064,141 L359I possibly damaging Het
Kidins220 A T 12: 25,036,455 I963L possibly damaging Het
Mdm4 T C 1: 133,003,863 R148G probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Ncor1 A T 11: 62,369,408 D505E probably benign Het
Necab3 A T 2: 154,554,687 L107Q probably damaging Het
Nkx2-4 G A 2: 147,085,194 P51L probably benign Het
Nol11 T C 11: 107,176,836 T388A probably benign Het
Npc1 T A 18: 12,200,820 M735L probably benign Het
Nr1h3 C A 2: 91,190,746 R232L probably benign Het
Nrcam T A 12: 44,544,897 probably null Het
Olfr341 G A 2: 36,479,782 T116I possibly damaging Het
Olfr591 T A 7: 103,172,996 I214L probably benign Het
Pabpn1 T C 14: 54,894,457 V101A probably damaging Het
Pcbp2 A G 15: 102,486,018 D217G probably benign Het
Pcdhb12 A G 18: 37,437,333 M511V probably benign Het
Phf3 T A 1: 30,821,266 K828* probably null Het
Plcg1 G C 2: 160,747,812 K85N probably benign Het
Prag1 A T 8: 36,146,737 T1148S probably benign Het
Prmt3 A G 7: 49,828,981 E430G probably null Het
Prx G T 7: 27,518,113 V819F probably damaging Het
Ptpn18 A T 1: 34,472,190 R338W probably null Het
Rab6a T C 7: 100,634,724 Y128H probably benign Het
Rgs2 T C 1: 144,001,759 Y186C probably damaging Het
Rhbdl1 C T 17: 25,834,883 V342M probably damaging Het
Rpn1 A G 6: 88,084,793 Q88R probably benign Het
Slc35e4 G A 11: 3,913,087 P34L possibly damaging Het
Slc7a6os A T 8: 106,210,557 D90E probably benign Het
Ssh3 A G 19: 4,269,025 V19A possibly damaging Het
Tcf19 A T 17: 35,514,897 M121K possibly damaging Het
Tcp11 G A 17: 28,080,219 R21C probably damaging Het
Tcp11l2 A G 10: 84,613,658 I496V probably damaging Het
Tenm3 C T 8: 48,276,382 A1530T Het
Tmem127 T A 2: 127,257,059 V171D probably damaging Het
Tyrp1 G A 4: 80,835,162 C30Y probably damaging Het
Usp48 A T 4: 137,613,769 D360V probably damaging Het
Vamp4 T A 1: 162,574,383 D11E possibly damaging Het
Vmn1r14 T C 6: 57,233,520 F28L probably benign Het
Vmn2r69 G T 7: 85,409,810 C514* probably null Het
Vmn2r84 G A 10: 130,391,099 A290V probably benign Het
Zhx3 T A 2: 160,780,771 Y492F probably benign Het
Other mutations in Slc19a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01464:Slc19a2 APN 1 164260861 missense probably damaging 1.00
IGL03231:Slc19a2 APN 1 164260880 missense probably damaging 1.00
R0324:Slc19a2 UTSW 1 164256775 missense probably damaging 1.00
R0709:Slc19a2 UTSW 1 164256798 missense probably damaging 1.00
R1117:Slc19a2 UTSW 1 164263456 missense possibly damaging 0.86
R1165:Slc19a2 UTSW 1 164263445 missense probably damaging 1.00
R1463:Slc19a2 UTSW 1 164257197 missense probably damaging 0.98
R1833:Slc19a2 UTSW 1 164262184 missense probably damaging 1.00
R2148:Slc19a2 UTSW 1 164262088 missense probably damaging 1.00
R2680:Slc19a2 UTSW 1 164249413 missense probably damaging 1.00
R4010:Slc19a2 UTSW 1 164260882 missense probably damaging 1.00
R5850:Slc19a2 UTSW 1 164263456 missense probably benign 0.00
R6279:Slc19a2 UTSW 1 164256775 missense probably damaging 1.00
R6300:Slc19a2 UTSW 1 164256775 missense probably damaging 1.00
R6907:Slc19a2 UTSW 1 164262754 missense possibly damaging 0.79
R6917:Slc19a2 UTSW 1 164261009 missense probably damaging 1.00
R6982:Slc19a2 UTSW 1 164256859 missense possibly damaging 0.88
R6993:Slc19a2 UTSW 1 164260822 missense probably benign 0.00
R7424:Slc19a2 UTSW 1 164260876 missense probably benign 0.31
R7575:Slc19a2 UTSW 1 164257122 missense probably damaging 1.00
R8193:Slc19a2 UTSW 1 164257225 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TATTTCTCCGGGGATAAGGGAG -3'
(R):5'- CCAAGGTGGCACTTCTACAG -3'

Sequencing Primer
(F):5'- AGGAATACATTCTTATGGCTTGTCG -3'
(R):5'- GGCACTTCTACAGTAGCTTGTGAC -3'
Posted On2021-07-15