Incidental Mutation 'R8855:Serpinb6c'
ID 675272
Institutional Source Beutler Lab
Gene Symbol Serpinb6c
Ensembl Gene ENSMUSG00000052180
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 6c
Synonyms Spi3C, SPIC, ovalbumin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock # R8855 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 33879816-33905708 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 33899326 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 35 (I35N)
Ref Sequence ENSEMBL: ENSMUSP00000127619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110273] [ENSMUST00000172184] [ENSMUST00000222216]
AlphaFold W4VSP4
Predicted Effect probably damaging
Transcript: ENSMUST00000110273
AA Change: I35N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105902
Gene: ENSMUSG00000052180
AA Change: I35N

DomainStartEndE-ValueType
SERPIN 13 378 7.5e-170 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000172184
AA Change: I35N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127619
Gene: ENSMUSG00000052180
AA Change: I35N

DomainStartEndE-ValueType
SERPIN 14 379 7.5e-170 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000222216
AA Change: I35N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 C T 3: 60,007,090 T38I probably benign Het
Ace T A 11: 105,970,598 L191* probably null Het
Ahctf1 G A 1: 179,786,776 H451Y probably damaging Het
Amotl1 C A 9: 14,555,573 probably null Het
Angptl6 T A 9: 20,875,644 Y261F probably damaging Het
Arhgap1 G T 2: 91,669,399 S293I probably benign Het
Atg9a A C 1: 75,185,223 F560V probably damaging Het
B4galnt4 G A 7: 141,068,575 G668D possibly damaging Het
Btaf1 T A 19: 36,958,501 N230K probably benign Het
Ccne1 A C 7: 38,100,621 H179Q probably benign Het
Cdk5rap2 A T 4: 70,300,650 D623E probably damaging Het
Cenpf C A 1: 189,653,233 K2283N probably benign Het
Clec16a A T 16: 10,644,867 D683V probably damaging Het
Clvs2 T C 10: 33,528,404 D272G probably benign Het
Cnksr1 A G 4: 134,232,183 V380A probably damaging Het
Col20a1 C A 2: 181,013,891 P42T Het
Ddx47 A G 6: 135,023,393 K451E probably benign Het
Dennd4a G A 9: 64,912,390 G1761D probably benign Het
Dnah11 T A 12: 118,192,372 H181L probably benign Het
Dync1h1 T C 12: 110,635,899 C2074R probably damaging Het
Ell2 A T 13: 75,769,674 Q574H probably damaging Het
Enpp7 A G 11: 118,988,365 N50S possibly damaging Het
Fbp2 T C 13: 62,841,895 K199R probably benign Het
Fetub A T 16: 22,939,571 E368V possibly damaging Het
Flt1 A T 5: 147,570,872 D1209E probably benign Het
Flt1 A T 5: 147,681,650 N260K probably damaging Het
Fras1 A G 5: 96,769,606 H3495R Het
Fsip2 A G 2: 82,980,177 Q2280R probably benign Het
Gja10 A T 4: 32,601,573 C270* probably null Het
Gpld1 A G 13: 24,986,907 T794A probably benign Het
Gsk3b A G 16: 38,184,538 Y157C probably damaging Het
Gsta2 T C 9: 78,337,598 K78R probably damaging Het
Gtf3a A G 5: 146,948,911 D44G probably benign Het
Hap1 C A 11: 100,356,038 G14W probably damaging Het
Hcn4 T A 9: 58,858,104 I623N unknown Het
Kank1 T C 19: 25,411,338 S792P possibly damaging Het
Klra5 A T 6: 129,903,570 W212R probably damaging Het
Kmt2d A T 15: 98,856,356 L1622Q unknown Het
Lipi T A 16: 75,558,593 D343V probably damaging Het
Lrp6 A T 6: 134,468,822 N1009K probably benign Het
Lrrc39 T A 3: 116,570,141 I121N probably damaging Het
Mamstr A T 7: 45,644,979 D419V probably benign Het
Map2k7 C T 8: 4,243,594 T119I probably damaging Het
Mov10l1 A T 15: 89,011,966 D671V probably benign Het
Mrps24 A T 11: 5,704,642 L104Q probably damaging Het
Myh1 T A 11: 67,211,421 L846H probably damaging Het
Ndufaf5 T A 2: 140,183,920 I133N possibly damaging Het
Ndufs5 A G 4: 123,715,862 probably null Het
Numa1 G C 7: 101,990,628 D62H possibly damaging Het
Olfr1512 A T 14: 52,372,739 Y105N probably damaging Het
Olfr551 G T 7: 102,588,738 Q2K probably benign Het
Olfr596 T A 7: 103,309,961 I80N probably damaging Het
Olfr876 C G 9: 37,804,413 F167L probably damaging Het
Pag1 T C 3: 9,699,469 K208R probably benign Het
Pkd1 T C 17: 24,573,077 V1246A probably damaging Het
Plekhg2 T C 7: 28,370,101 T144A probably benign Het
Plekhm2 A T 4: 141,634,347 S262T probably benign Het
Pramef17 A T 4: 143,994,335 L12Q probably damaging Het
Prpf4 A G 4: 62,415,998 D230G probably benign Het
Rbm15b C T 9: 106,886,396 R191Q probably benign Het
Sec16a G A 2: 26,439,840 T721I probably benign Het
Sgk1 T G 10: 21,995,827 S181A probably benign Het
Slc25a10 T C 11: 120,494,969 S74P probably damaging Het
Slc30a3 C A 5: 31,087,981 V332F possibly damaging Het
Smg1 A G 7: 118,206,899 S240P unknown Het
Snapc4 G A 2: 26,374,533 R265W probably damaging Het
Taar1 C T 10: 23,921,078 R225C possibly damaging Het
Tmem74 A G 15: 43,866,835 S271P probably damaging Het
Trank1 T C 9: 111,312,221 V127A unknown Het
Trim66 G T 7: 109,481,981 H244N probably damaging Het
Tshz2 T A 2: 169,886,505 L1007H probably damaging Het
Ttc39c A T 18: 12,697,946 S288C probably benign Het
Twnk C T 19: 45,011,833 Q663* probably null Het
Ucn T A 5: 31,138,513 Q3L probably benign Het
Usp9y C T Y: 1,395,758 R492H probably damaging Het
Vars T C 17: 35,015,644 S1150P probably benign Het
Zc3h7b G A 15: 81,772,480 R166Q probably benign Het
Zfand1 T C 3: 10,340,751 D264G probably benign Het
Zfp839 A G 12: 110,868,414 E701G probably benign Het
Other mutations in Serpinb6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00852:Serpinb6c APN 13 33897338 splice site probably null
IGL01900:Serpinb6c APN 13 33880190 missense possibly damaging 0.88
IGL01983:Serpinb6c APN 13 33897334 splice site probably benign
IGL03357:Serpinb6c APN 13 33895386 missense probably benign 0.08
R0208:Serpinb6c UTSW 13 33897396 missense probably benign
R0242:Serpinb6c UTSW 13 33899247 splice site probably benign
R0632:Serpinb6c UTSW 13 33880031 missense possibly damaging 0.86
R0669:Serpinb6c UTSW 13 33899269 missense probably damaging 0.98
R0848:Serpinb6c UTSW 13 33899305 missense probably damaging 1.00
R1657:Serpinb6c UTSW 13 33880226 missense probably benign 0.01
R3911:Serpinb6c UTSW 13 33893905 missense probably benign 0.00
R5135:Serpinb6c UTSW 13 33880097 missense probably damaging 1.00
R5275:Serpinb6c UTSW 13 33893817 missense probably damaging 1.00
R5295:Serpinb6c UTSW 13 33893817 missense probably damaging 1.00
R5700:Serpinb6c UTSW 13 33899308 missense probably damaging 1.00
R7490:Serpinb6c UTSW 13 33893835 missense probably benign 0.04
R7514:Serpinb6c UTSW 13 33897403 nonsense probably null
R7517:Serpinb6c UTSW 13 33895295 missense probably damaging 1.00
R7547:Serpinb6c UTSW 13 33893892 missense possibly damaging 0.80
R7730:Serpinb6c UTSW 13 33899309 missense probably damaging 1.00
R8121:Serpinb6c UTSW 13 33880218 missense probably benign 0.38
R8142:Serpinb6c UTSW 13 33880113 missense probably benign 0.00
R8745:Serpinb6c UTSW 13 33880719 missense probably benign 0.06
R8866:Serpinb6c UTSW 13 33899326 missense probably damaging 1.00
R9412:Serpinb6c UTSW 13 33897388 missense probably benign 0.00
X0063:Serpinb6c UTSW 13 33880705 missense possibly damaging 0.76
Z1088:Serpinb6c UTSW 13 33893872 missense probably damaging 1.00
Z1088:Serpinb6c UTSW 13 33893923 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTATCACATCCTGCCCATCATG -3'
(R):5'- TGTGCCTTGTTCACTGAGTCAG -3'

Sequencing Primer
(F):5'- ATCATGTCTCCAGTCACACCC -3'
(R):5'- GTTCACTGAGTCAGAGTATCACAGTG -3'
Posted On 2021-07-15