Incidental Mutation 'R8902:Casp1'
ID 678246
Institutional Source Beutler Lab
Gene Symbol Casp1
Ensembl Gene ENSMUSG00000025888
Gene Name caspase 1
Synonyms ICE, Il1bc, Caspase-1, interleukin 1 beta-converting enzyme
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8902 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 5298517-5307265 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 5299333 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 21 (T21A)
Ref Sequence ENSEMBL: ENSMUSP00000027015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027015]
AlphaFold P29452
Predicted Effect probably benign
Transcript: ENSMUST00000027015
AA Change: T21A

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027015
Gene: ENSMUSG00000025888
AA Change: T21A

DomainStartEndE-ValueType
CARD 4 89 4.91e-19 SMART
CASc 151 400 1.82e-136 SMART
Meta Mutation Damage Score 0.3086 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce 2 subunits, large and small, that dimerize to form the active enzyme. This gene was identified by its ability to proteolytically cleave and activate the inactive precursor of interleukin-1, a cytokine involved in the processes such as inflammation, septic shock, and wound healing. This gene has been shown to induce cell apoptosis and may function in various developmental stages. Studies of a similar gene in mouse suggest a role in the pathogenesis of Huntington disease. Alternative splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous targeted mutants fail to produce mature IL1A and IL1B and are resistant to LPS-induced endotoxin shock and to FAS antibody-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 G T 4: 155,905,914 R819L possibly damaging Het
App A G 16: 85,079,879 V208A unknown Het
C1qtnf7 G A 5: 43,615,862 E168K probably damaging Het
Cacna1e C T 1: 154,473,886 M757I probably benign Het
Ccdc92 C T 5: 124,835,641 A275T possibly damaging Het
Ccr4 T A 9: 114,496,552 probably benign Het
Cct8l1 C T 5: 25,517,910 T541I probably benign Het
Chrng G T 1: 87,210,675 R396L possibly damaging Het
Cmip A G 8: 117,377,186 T50A probably damaging Het
Ddx21 C A 10: 62,598,707 S91I probably benign Het
Dnmbp A G 19: 43,901,786 L514P probably benign Het
Echs1 A T 7: 140,110,586 M191K probably damaging Het
Eps8 A G 6: 137,512,177 S408P probably damaging Het
Fat2 T C 11: 55,310,070 E726G probably damaging Het
Fpr2 T C 17: 17,892,928 I62T probably benign Het
Gemin4 G A 11: 76,212,022 Q638* probably null Het
Glrb A T 3: 80,861,978 N147K probably damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gtf2i T C 5: 134,249,866 N637S probably benign Het
Hivep3 A G 4: 120,096,740 E751G possibly damaging Het
Ifnb1 G T 4: 88,522,310 N155K probably damaging Het
Igf2bp3 G T 6: 49,088,431 T509K probably damaging Het
Igsf10 T C 3: 59,336,212 M234V probably benign Het
Iqgap2 C T 13: 95,682,203 A682T probably benign Het
Ireb2 T G 9: 54,892,502 M409R probably benign Het
Kat6b C T 14: 21,669,561 T1327I probably benign Het
Krtap5-5 A G 7: 142,229,893 S7P unknown Het
Lelp1 A T 3: 92,135,671 C24S unknown Het
Malrd1 A T 2: 16,255,334 K2122* probably null Het
Mei1 C A 15: 82,070,011 R6S unknown Het
Meis3 T A 7: 16,177,962 I119N probably benign Het
Mmp20 T C 9: 7,639,287 V152A probably benign Het
Muc6 T A 7: 141,647,524 I797F possibly damaging Het
Myo7a C T 7: 98,092,613 E439K probably damaging Het
Neb C A 2: 52,243,210 A3439S probably damaging Het
Nfe2l1 T A 11: 96,817,794 D715V unknown Het
Obscn C A 11: 59,135,936 R147L probably benign Het
Olfr10 A T 11: 49,318,379 T278S probably benign Het
Olfr1166 A G 2: 88,124,434 S184P probably damaging Het
Olfr126 T A 17: 37,851,210 M206K probably benign Het
Olfr1507 G A 14: 52,490,553 T137I probably benign Het
Olfr164 T A 16: 19,286,633 I37F probably damaging Het
Plg T A 17: 12,410,903 F608Y probably benign Het
Plppr1 C A 4: 49,319,836 P154Q probably damaging Het
Ppp2r5e T C 12: 75,453,796 K441R probably benign Het
Prkaca T C 8: 83,977,085 S5P probably benign Het
Rbl1 T C 2: 157,199,500 K69R probably benign Het
Rbpms2 T C 9: 65,651,069 I129T probably benign Het
Serpina1c A T 12: 103,898,858 N176K probably damaging Het
Sgsm3 C T 15: 81,006,595 H117Y probably damaging Het
Sphkap A T 1: 83,278,964 C355S probably benign Het
Stpg2 T A 3: 139,298,409 V249E probably damaging Het
Syt2 T C 1: 134,747,653 V414A possibly damaging Het
Tiam2 T C 17: 3,477,196 I1050T probably benign Het
Tmem131 A T 1: 36,808,965 I1134N probably damaging Het
Ttc23 A G 7: 67,693,013 E293G Het
Ttc41 C A 10: 86,713,001 R20S probably benign Het
Ttn C T 2: 76,740,789 V26587M probably damaging Het
Ugt2a2 T C 5: 87,460,411 K523R possibly damaging Het
Unc13c A G 9: 73,749,548 C1124R probably damaging Het
Ush2a T A 1: 188,443,084 N1126K probably damaging Het
Usp36 A T 11: 118,275,014 L326Q probably damaging Het
Zfp568 T C 7: 30,013,882 M120T probably benign Het
Zfp944 T C 17: 22,339,780 D162G probably benign Het
Other mutations in Casp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Casp1 APN 9 5299872 splice site probably benign
IGL00667:Casp1 APN 9 5303756 missense probably benign 0.40
IGL01998:Casp1 APN 9 5303043 missense probably damaging 1.00
IGL02248:Casp1 APN 9 5299452 missense probably benign 0.01
IGL02469:Casp1 APN 9 5303105 missense probably benign 0.19
P0027:Casp1 UTSW 9 5299851 missense probably benign 0.00
PIT4305001:Casp1 UTSW 9 5306135 missense probably benign 0.03
R0724:Casp1 UTSW 9 5303077 missense probably benign
R1169:Casp1 UTSW 9 5299454 missense possibly damaging 0.93
R1876:Casp1 UTSW 9 5303663 missense probably benign 0.01
R2316:Casp1 UTSW 9 5306213 missense possibly damaging 0.92
R2877:Casp1 UTSW 9 5303110 missense probably damaging 1.00
R2885:Casp1 UTSW 9 5299851 missense probably benign 0.00
R4043:Casp1 UTSW 9 5302444 missense probably benign
R4367:Casp1 UTSW 9 5299333 missense probably benign 0.41
R4656:Casp1 UTSW 9 5304324 missense probably damaging 1.00
R4705:Casp1 UTSW 9 5306204 missense probably damaging 1.00
R4790:Casp1 UTSW 9 5303020 missense probably benign 0.01
R4858:Casp1 UTSW 9 5306742 missense probably damaging 1.00
R5607:Casp1 UTSW 9 5303143 missense probably damaging 1.00
R5784:Casp1 UTSW 9 5299337 missense probably damaging 0.98
R6578:Casp1 UTSW 9 5304280 missense probably benign 0.04
R7111:Casp1 UTSW 9 5299816 missense probably benign 0.01
R7215:Casp1 UTSW 9 5298523 splice site probably null
R7590:Casp1 UTSW 9 5306710 missense probably damaging 1.00
R8002:Casp1 UTSW 9 5303164 missense possibly damaging 0.94
R8510:Casp1 UTSW 9 5303026 missense probably damaging 1.00
R9234:Casp1 UTSW 9 5303128 missense probably benign 0.04
T0722:Casp1 UTSW 9 5299851 missense probably benign 0.00
X0003:Casp1 UTSW 9 5299851 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACGCTGTATGTGAAAGGGAC -3'
(R):5'- TGGTCTAAGATTCAGGCTCTTAC -3'

Sequencing Primer
(F):5'- AGGGACATTTTGCTGATTCACTC -3'
(R):5'- GATTGAAGCTCCAGAATTCCTGC -3'
Posted On 2021-08-02