Incidental Mutation 'R9076:Sstr2'
ID 689813
Institutional Source Beutler Lab
Gene Symbol Sstr2
Ensembl Gene ENSMUSG00000047904
Gene Name somatostatin receptor 2
Synonyms SSTR-2, Smstr2, Smstr-2, sst2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.716) question?
Stock # R9076 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 113619342-113626028 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 113624351 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 32 (N32S)
Ref Sequence ENSEMBL: ENSMUSP00000102241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067591] [ENSMUST00000106630] [ENSMUST00000125890] [ENSMUST00000136392] [ENSMUST00000146031] [ENSMUST00000146390]
AlphaFold P30875
Predicted Effect probably benign
Transcript: ENSMUST00000067591
AA Change: N32S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000068578
Gene: ENSMUSG00000047904
AA Change: N32S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 51 281 1.1e-10 PFAM
Pfam:7TM_GPCR_Srsx 54 327 1.9e-20 PFAM
Pfam:7tm_1 60 312 2.5e-70 PFAM
Pfam:7TM_GPCR_Srv 118 329 4.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106630
AA Change: N32S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000102241
Gene: ENSMUSG00000047904
AA Change: N32S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 51 284 1.3e-10 PFAM
Pfam:7TM_GPCR_Srsx 54 327 1.9e-20 PFAM
Pfam:7tm_1 60 312 1.4e-65 PFAM
Pfam:7TM_GPCR_Srv 119 328 4.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125890
SMART Domains Protein: ENSMUSP00000115472
Gene: ENSMUSG00000041654

DomainStartEndE-ValueType
Pfam:Zip 7 200 3.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136392
Predicted Effect probably benign
Transcript: ENSMUST00000146031
SMART Domains Protein: ENSMUSP00000121286
Gene: ENSMUSG00000041654

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000138101
Gene: ENSMUSG00000047904
AA Change: N32S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 51 284 1.8e-10 PFAM
Pfam:7TM_GPCR_Srsx 54 327 2.4e-20 PFAM
Pfam:7tm_1 60 312 3.1e-70 PFAM
Pfam:7TM_GPCR_Srv 118 329 5.7e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a receptor for somatostatin, which acts at many sites to inhibit the release of several hormones and other secretory proteins. The encoded protein is a member of the superfamily of receptors having seven transmembrane segments and is involved in many processes, including adenylyl cyclase inhibition, phosphotyrosine phosphatase stimulation, and inhibition of calcium entry and cell growth. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a null allele show elevated anxiety and locomotor and exploratory deficits. Homozygotes for a reporter allele show altered motor coordination, somatostatin-induced dopamine and glutamate release, retinal rod bipolar cells and EEG patterns, and reduced infarction after focal ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik CGAATCTGCACACTGAGGACTTGGCCCTGGGATGCATGCAGGAGAATCTGCACACTGAGGACTTGGCCCTGGGATGCATGCAGGAGAATCTGCACACTGAGGACTTGGCCCTGGGATGCATGCAGGAGAATCTGCACACTGAGGACTTGGCCCTGGGATGTATGCAGGAGAATCTGCACACTGAGGACTTGGCCCTGGG CGAATCTGCACACTGAGGACTTGGCCCTGGGATGCATGCAGGAGAATCTGCACACTGAGGACTTGGCCCTGGGATGCATGCAGGAGAATCTGCACACTGAGGACTTGGCCCTGGGATGTATGCAGGAGAATCTGCACACTGAGGACTTGGCCCTGGG 10: 82,288,556 probably benign Het
Adcy7 G A 8: 88,327,708 G1064R probably damaging Het
Adcy9 A G 16: 4,288,823 V1046A probably damaging Het
Adgrv1 C T 13: 81,422,128 probably null Het
Apbb2 A C 5: 66,312,164 L554W probably damaging Het
Arhgef10 C T 8: 14,974,993 P722S probably damaging Het
Capns1 A C 7: 30,194,085 M1R probably null Het
Chst1 C T 2: 92,613,416 Q78* probably null Het
Clec12b A G 6: 129,379,617 S195P possibly damaging Het
Cog8 C T 8: 107,052,576 M356I probably damaging Het
Cyp4b1 T C 4: 115,625,227 N452D probably damaging Het
Defb40 A T 8: 18,974,978 Y71N probably benign Het
Dhx8 G T 11: 101,738,195 R190L Het
Disp1 G A 1: 183,087,235 T1207M possibly damaging Het
Dnah9 T A 11: 66,117,638 Y787F probably benign Het
Egflam T C 15: 7,207,674 N1010D probably damaging Het
Fam151a T A 4: 106,746,057 Y272N probably damaging Het
Fat1 T C 8: 45,039,901 Y3887H probably damaging Het
Fpr3 T A 17: 17,971,463 I332N probably benign Het
Frmd4a G T 2: 4,603,954 G878W probably damaging Het
Fv1 T C 4: 147,869,171 Y65H possibly damaging Het
Gabra6 G A 11: 42,307,462 A387V probably benign Het
Gm34653 A T 2: 34,839,197 Y336F probably damaging Het
Gna11 T C 10: 81,530,881 T332A Het
Gpr161 T A 1: 165,306,188 H6Q possibly damaging Het
Grin2b CA C 6: 135,732,511 probably null Het
Heatr3 A T 8: 88,150,199 M290L probably benign Het
Ifi47 T G 11: 49,096,015 I203R probably benign Het
Ighv5-8 TATACAT TAT 12: 113,654,963 probably benign Het
Klhl10 A G 11: 100,447,136 M234V possibly damaging Het
Klra4 A G 6: 130,062,144 I95T possibly damaging Het
Krt84 A G 15: 101,529,663 F286L probably damaging Het
Lrp2 A G 2: 69,519,916 V704A probably benign Het
Lypd6b A T 2: 49,947,522 S169C possibly damaging Het
Mapk12 T C 15: 89,140,408 E22G probably benign Het
Ncapg T C 5: 45,676,641 C340R probably benign Het
Ncor2 A G 5: 125,034,022 L394P Het
Nek1 T G 8: 61,028,734 S228A probably damaging Het
Olfr1224-ps1 C T 2: 89,156,375 E267K possibly damaging Het
Olfr314 T A 11: 58,786,733 F166L possibly damaging Het
Olfr320 T C 11: 58,683,896 C8R probably benign Het
Olfr329-ps A T 11: 58,542,956 C186* probably null Het
Olfr657 C T 7: 104,636,084 R137C probably benign Het
Pcdha8 C A 18: 36,993,232 P256T possibly damaging Het
Pmm1 C T 15: 81,955,695 R143H probably damaging Het
Ptprn A T 1: 75,252,374 M799K probably damaging Het
Sae1 A G 7: 16,336,743 F281L probably benign Het
Slc25a23 A G 17: 57,047,309 Y366H probably benign Het
Slc25a25 G T 2: 32,419,163 T222K probably damaging Het
Smarca2 T A 19: 26,682,052 F914Y possibly damaging Het
Spef2 C A 15: 9,653,005 V897L probably benign Het
Spon2 C A 5: 33,216,710 E110* probably null Het
Stk4 T C 2: 164,118,065 V415A probably benign Het
Tcaf1 T G 6: 42,677,438 T607P probably benign Het
Ush1c C A 7: 46,201,056 L766F probably damaging Het
Usp9y T C Y: 1,383,354 I795V probably benign Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vmn2r53 A G 7: 12,606,304 S81P probably damaging Het
Wdr6 A G 9: 108,574,428 V752A probably benign Het
Xkr4 G A 1: 3,216,135 R611* probably null Het
Zc3h6 T G 2: 129,017,176 Y1042* probably null Het
Zfp236 A G 18: 82,620,344 S1384P possibly damaging Het
Zfp800 A T 6: 28,243,216 N583K probably benign Het
Zpld1 T C 16: 55,241,401 S206G probably benign Het
Zxdc T A 6: 90,372,839 S372R probably damaging Het
Other mutations in Sstr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Sstr2 APN 11 113624995 missense probably benign 0.22
IGL01555:Sstr2 APN 11 113625619 missense probably benign 0.32
IGL02173:Sstr2 APN 11 113625016 missense probably damaging 1.00
IGL02430:Sstr2 APN 11 113624804 missense probably damaging 0.99
chat UTSW 11 113624549 missense probably damaging 1.00
R0125:Sstr2 UTSW 11 113624477 missense probably damaging 1.00
R0565:Sstr2 UTSW 11 113625619 missense probably benign 0.32
R1227:Sstr2 UTSW 11 113624885 missense probably damaging 0.99
R1356:Sstr2 UTSW 11 113624894 missense probably damaging 1.00
R1992:Sstr2 UTSW 11 113624669 missense probably benign 0.03
R2504:Sstr2 UTSW 11 113624431 missense probably damaging 0.98
R2509:Sstr2 UTSW 11 113624923 missense probably damaging 0.99
R2510:Sstr2 UTSW 11 113624923 missense probably damaging 0.99
R2511:Sstr2 UTSW 11 113624923 missense probably damaging 0.99
R4051:Sstr2 UTSW 11 113624656 missense probably damaging 1.00
R4083:Sstr2 UTSW 11 113625245 missense probably benign 0.05
R4207:Sstr2 UTSW 11 113624656 missense probably damaging 1.00
R4208:Sstr2 UTSW 11 113624656 missense probably damaging 1.00
R5666:Sstr2 UTSW 11 113624713 missense probably damaging 1.00
R6264:Sstr2 UTSW 11 113625106 missense probably damaging 1.00
R6339:Sstr2 UTSW 11 113624549 missense probably damaging 1.00
R6443:Sstr2 UTSW 11 113625254 splice site probably null
R6968:Sstr2 UTSW 11 113624948 missense probably damaging 1.00
R7146:Sstr2 UTSW 11 113625353 missense probably damaging 1.00
R7735:Sstr2 UTSW 11 113624597 missense possibly damaging 0.75
R8057:Sstr2 UTSW 11 113624273 missense probably benign
R8086:Sstr2 UTSW 11 113625172 missense probably damaging 1.00
R8087:Sstr2 UTSW 11 113624675 missense probably damaging 1.00
R9194:Sstr2 UTSW 11 113624377 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TAAGTAGCCTGGGACTGACG -3'
(R):5'- AGTTCATCTGCAATGGCCAGG -3'

Sequencing Primer
(F):5'- GATGTCACAGTAGAATCTTGGCCC -3'
(R):5'- TCATCTGCAATGGCCAGGTTAAG -3'
Posted On 2021-11-19