Incidental Mutation 'R9194:Sstr2'
ID 697870
Institutional Source Beutler Lab
Gene Symbol Sstr2
Ensembl Gene ENSMUSG00000047904
Gene Name somatostatin receptor 2
Synonyms SSTR-2, Smstr2, Smstr-2, sst2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.672) question?
Stock # R9194 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 113619342-113626028 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 113624377 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 41 (T41A)
Ref Sequence ENSEMBL: ENSMUSP00000102241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067591] [ENSMUST00000106630] [ENSMUST00000125890] [ENSMUST00000136392] [ENSMUST00000146031] [ENSMUST00000146390]
AlphaFold P30875
Predicted Effect probably benign
Transcript: ENSMUST00000067591
AA Change: T41A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000068578
Gene: ENSMUSG00000047904
AA Change: T41A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 51 281 1.1e-10 PFAM
Pfam:7TM_GPCR_Srsx 54 327 1.9e-20 PFAM
Pfam:7tm_1 60 312 2.5e-70 PFAM
Pfam:7TM_GPCR_Srv 118 329 4.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106630
AA Change: T41A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000102241
Gene: ENSMUSG00000047904
AA Change: T41A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 51 284 1.3e-10 PFAM
Pfam:7TM_GPCR_Srsx 54 327 1.9e-20 PFAM
Pfam:7tm_1 60 312 1.4e-65 PFAM
Pfam:7TM_GPCR_Srv 119 328 4.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125890
SMART Domains Protein: ENSMUSP00000115472
Gene: ENSMUSG00000041654

DomainStartEndE-ValueType
Pfam:Zip 7 200 3.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136392
Predicted Effect probably benign
Transcript: ENSMUST00000146031
SMART Domains Protein: ENSMUSP00000121286
Gene: ENSMUSG00000041654

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146390
AA Change: T41A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000138101
Gene: ENSMUSG00000047904
AA Change: T41A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 51 284 1.8e-10 PFAM
Pfam:7TM_GPCR_Srsx 54 327 2.4e-20 PFAM
Pfam:7tm_1 60 312 3.1e-70 PFAM
Pfam:7TM_GPCR_Srv 118 329 5.7e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a receptor for somatostatin, which acts at many sites to inhibit the release of several hormones and other secretory proteins. The encoded protein is a member of the superfamily of receptors having seven transmembrane segments and is involved in many processes, including adenylyl cyclase inhibition, phosphotyrosine phosphatase stimulation, and inhibition of calcium entry and cell growth. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a null allele show elevated anxiety and locomotor and exploratory deficits. Homozygotes for a reporter allele show altered motor coordination, somatostatin-induced dopamine and glutamate release, retinal rod bipolar cells and EEG patterns, and reduced infarction after focal ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,259,088 M1K probably null Het
Adra1b A T 11: 43,835,436 V218D probably damaging Het
Ank1 A G 8: 23,116,239 S1216G possibly damaging Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Cfap44 G T 16: 44,468,461 D1525Y probably damaging Het
Chd8 A T 14: 52,202,193 M2341K probably benign Het
Chst11 A G 10: 83,191,485 T249A probably damaging Het
Cttnbp2 A G 6: 18,434,851 V336A probably benign Het
Dennd3 T C 15: 73,547,304 L648P probably benign Het
Dgcr14 A T 16: 17,910,164 D79E probably damaging Het
Dhx16 T C 17: 35,889,281 V864A probably benign Het
Enpp3 G A 10: 24,799,194 H362Y possibly damaging Het
Fam83c T A 2: 155,829,379 Y712F probably damaging Het
Helz C T 11: 107,670,287 Q1392* probably null Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Iqch T C 9: 63,572,679 H143R probably benign Het
Itgb5 A G 16: 33,900,511 D315G probably damaging Het
Kcnmb2 A G 3: 32,182,025 K141R probably benign Het
Lrrc37a G A 11: 103,500,850 P1250S probably benign Het
Mcm5 T G 8: 75,110,334 V110G probably damaging Het
Med27 G A 2: 29,471,300 D163N probably damaging Het
Mms22l C A 4: 24,600,185 Y1129* probably null Het
Mov10l1 G A 15: 89,046,820 R1081H probably damaging Het
Mtpap C G 18: 4,380,833 N170K probably benign Het
Mtpap C T 18: 4,380,834 Q171* probably null Het
Myo6 T A 9: 80,246,554 F271I unknown Het
Ndst4 C T 3: 125,724,736 S354L probably benign Het
Nfatc1 C T 18: 80,708,043 A26T probably benign Het
Olfr867 C A 9: 20,055,247 C72F probably damaging Het
Piezo2 G C 18: 63,117,744 T428S probably benign Het
Prkch A G 12: 73,721,842 E462G probably damaging Het
Rbm20 A G 19: 53,834,700 Y576C probably damaging Het
Riok3 TTTCATT TTT 18: 12,149,585 probably null Het
Rpp40 C T 13: 35,896,915 D302N probably benign Het
Sash1 A G 10: 8,740,205 V631A probably damaging Het
Thsd7b T A 1: 129,915,634 V861E possibly damaging Het
Tomm70a A G 16: 57,152,707 K603E possibly damaging Het
Tpd52l2 T A 2: 181,499,890 M22K possibly damaging Het
Tpst1 T A 5: 130,102,019 L110Q possibly damaging Het
Tram1l1 A G 3: 124,321,488 Y99C possibly damaging Het
Ttc39b A G 4: 83,263,740 F81L possibly damaging Het
Ubr1 A G 2: 120,947,844 Y238H probably damaging Het
Vmn1r202 G T 13: 22,502,146 H34N possibly damaging Het
Vmn1r36 G A 6: 66,716,052 Q280* probably null Het
Xpnpep1 A T 19: 53,011,858 V187E possibly damaging Het
Zfp592 A G 7: 81,024,601 I438V probably benign Het
Other mutations in Sstr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Sstr2 APN 11 113624995 missense probably benign 0.22
IGL01555:Sstr2 APN 11 113625619 missense probably benign 0.32
IGL02173:Sstr2 APN 11 113625016 missense probably damaging 1.00
IGL02430:Sstr2 APN 11 113624804 missense probably damaging 0.99
chat UTSW 11 113624549 missense probably damaging 1.00
R0125:Sstr2 UTSW 11 113624477 missense probably damaging 1.00
R0565:Sstr2 UTSW 11 113625619 missense probably benign 0.32
R1227:Sstr2 UTSW 11 113624885 missense probably damaging 0.99
R1356:Sstr2 UTSW 11 113624894 missense probably damaging 1.00
R1992:Sstr2 UTSW 11 113624669 missense probably benign 0.03
R2504:Sstr2 UTSW 11 113624431 missense probably damaging 0.98
R2509:Sstr2 UTSW 11 113624923 missense probably damaging 0.99
R2510:Sstr2 UTSW 11 113624923 missense probably damaging 0.99
R2511:Sstr2 UTSW 11 113624923 missense probably damaging 0.99
R4051:Sstr2 UTSW 11 113624656 missense probably damaging 1.00
R4083:Sstr2 UTSW 11 113625245 missense probably benign 0.05
R4207:Sstr2 UTSW 11 113624656 missense probably damaging 1.00
R4208:Sstr2 UTSW 11 113624656 missense probably damaging 1.00
R5666:Sstr2 UTSW 11 113624713 missense probably damaging 1.00
R6264:Sstr2 UTSW 11 113625106 missense probably damaging 1.00
R6339:Sstr2 UTSW 11 113624549 missense probably damaging 1.00
R6443:Sstr2 UTSW 11 113625254 splice site probably null
R6968:Sstr2 UTSW 11 113624948 missense probably damaging 1.00
R7146:Sstr2 UTSW 11 113625353 missense probably damaging 1.00
R7735:Sstr2 UTSW 11 113624597 missense possibly damaging 0.75
R8057:Sstr2 UTSW 11 113624273 missense probably benign
R8086:Sstr2 UTSW 11 113625172 missense probably damaging 1.00
R8087:Sstr2 UTSW 11 113624675 missense probably damaging 1.00
R9076:Sstr2 UTSW 11 113624351 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCACAGTAGAATCTTGGCCCC -3'
(R):5'- CAAAAGGCCAGTGGACTAGC -3'

Sequencing Primer
(F):5'- TAGAATCTTGGCCCCCAGAGTC -3'
(R):5'- CACCTGCATGGCCAAGAAGG -3'
Posted On 2022-02-07