Incidental Mutation 'R9118:Casc1'
ID 692638
Institutional Source Beutler Lab
Gene Symbol Casc1
Ensembl Gene ENSMUSG00000043541
Gene Name cancer susceptibility candidate 1
Synonyms A230084G12Rik, Las1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R9118 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 145174834-145211005 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 145175174 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 691 (Y691H)
Ref Sequence ENSEMBL: ENSMUSP00000062279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032396] [ENSMUST00000060797] [ENSMUST00000111728] [ENSMUST00000135984] [ENSMUST00000204105]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000032396
SMART Domains Protein: ENSMUSP00000032396
Gene: ENSMUSG00000030263

DomainStartEndE-ValueType
Pfam:MRVI1 10 539 3.2e-265 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000060797
AA Change: Y691H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062279
Gene: ENSMUSG00000043541
AA Change: Y691H

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:Casc1_N 29 229 5.5e-61 PFAM
Pfam:Casc1 241 469 3.4e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111728
AA Change: Y640H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107357
Gene: ENSMUSG00000043541
AA Change: Y640H

DomainStartEndE-ValueType
coiled coil region 1 45 N/A INTRINSIC
Pfam:Casc1 228 456 6.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132948
SMART Domains Protein: ENSMUSP00000120248
Gene: ENSMUSG00000030263

DomainStartEndE-ValueType
Pfam:MRVI1 8 504 3.7e-248 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135984
Predicted Effect probably benign
Transcript: ENSMUST00000204105
SMART Domains Protein: ENSMUSP00000144783
Gene: ENSMUSG00000043541

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:Casc1_N 29 229 3.4e-57 PFAM
Pfam:Casc1 241 469 2.3e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (31/32)
MGI Phenotype PHENOTYPE: Mice with disruptions of this gene display a higher incidence of lung tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b A T 9: 119,156,889 S36T probably benign Het
Aifm2 C T 10: 61,725,902 T9I probably benign Het
Ano5 T A 7: 51,570,374 F421I probably damaging Het
Cacna1a G A 8: 84,536,086 V372M probably damaging Het
Cbwd1 T C 19: 24,942,684 R190G probably damaging Het
Col6a5 A T 9: 105,878,654 probably benign Het
Colgalt2 A G 1: 152,503,155 probably benign Het
Crybg1 T C 10: 44,003,929 D421G possibly damaging Het
Dgat1 A T 15: 76,502,518 W440R probably damaging Het
Dnah5 TGTCCGACTACAACATCGAGACGGCCAAGCGCGTC TGTC 15: 28,401,848 probably null Het
Eif4h C A 5: 134,627,627 V70L probably benign Het
Gabrd C A 4: 155,386,018 V326L possibly damaging Het
Krt2 C T 15: 101,814,541 E341K probably damaging Het
Lrp4 C T 2: 91,478,582 A538V possibly damaging Het
Mfap3l G A 8: 60,656,682 V31M probably damaging Het
Mroh2b T C 15: 4,962,091 I1557T possibly damaging Het
Olfr1388 A T 11: 49,444,582 I244F probably benign Het
Olfr235 T C 19: 12,268,899 V223A probably benign Het
Pcyt2 G A 11: 120,613,073 P183L Het
Rapsn A G 2: 91,045,033 H387R probably damaging Het
Scaf11 G A 15: 96,422,005 A259V probably benign Het
Sept9 A G 11: 117,266,572 D11G probably benign Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Slc7a2 T A 8: 40,898,957 I19N possibly damaging Het
Synpr T C 14: 13,608,673 V171A probably damaging Het
Tmed7 T C 18: 46,593,271 N139S probably benign Het
Tnks1bp1 G T 2: 85,063,376 G1216W probably damaging Het
Ush2a T A 1: 188,654,642 V2338E probably damaging Het
Vmn1r152 A T 7: 22,523,567 I201F Het
Vmn2r106 C A 17: 20,285,405 W9L probably benign Het
Vmn2r9 A G 5: 108,843,071 V808A probably damaging Het
Zfp646 A G 7: 127,881,638 T996A Het
Other mutations in Casc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Casc1 APN 6 145175290 missense probably benign 0.00
IGL00586:Casc1 APN 6 145191576 missense possibly damaging 0.53
IGL01066:Casc1 APN 6 145176222 missense probably damaging 0.96
IGL01413:Casc1 APN 6 145175086 missense probably damaging 1.00
IGL02275:Casc1 APN 6 145177364 missense probably damaging 1.00
IGL02668:Casc1 APN 6 145205257 missense unknown
IGL03018:Casc1 APN 6 145183305 missense probably damaging 1.00
IGL03233:Casc1 APN 6 145181885 missense probably damaging 1.00
R0011:Casc1 UTSW 6 145179055 missense probably damaging 1.00
R0011:Casc1 UTSW 6 145179055 missense probably damaging 1.00
R0180:Casc1 UTSW 6 145183218 critical splice donor site probably benign
R0786:Casc1 UTSW 6 145181757 critical splice donor site probably null
R1916:Casc1 UTSW 6 145176200 missense probably benign 0.37
R2117:Casc1 UTSW 6 145205241 critical splice donor site probably null
R2174:Casc1 UTSW 6 145175170 missense probably damaging 1.00
R2264:Casc1 UTSW 6 145208429 utr 5 prime probably benign
R4393:Casc1 UTSW 6 145194578 missense possibly damaging 0.49
R4467:Casc1 UTSW 6 145183218 critical splice donor site probably null
R4847:Casc1 UTSW 6 145175185 missense probably damaging 1.00
R5014:Casc1 UTSW 6 145183266 missense probably damaging 1.00
R5207:Casc1 UTSW 6 145179068 missense probably damaging 1.00
R5264:Casc1 UTSW 6 145181776 missense probably benign 0.02
R5359:Casc1 UTSW 6 145196892 missense probably damaging 1.00
R5499:Casc1 UTSW 6 145177431 missense probably damaging 1.00
R6211:Casc1 UTSW 6 145200491 missense probably damaging 1.00
R6579:Casc1 UTSW 6 145179018 missense probably benign 0.19
R6939:Casc1 UTSW 6 145175219 missense possibly damaging 0.46
R7108:Casc1 UTSW 6 145185865 nonsense probably null
R7131:Casc1 UTSW 6 145177406 missense probably null 0.97
R7810:Casc1 UTSW 6 145194586 missense probably benign 0.28
R8017:Casc1 UTSW 6 145194557 missense probably damaging 1.00
R8385:Casc1 UTSW 6 145175192 missense probably damaging 1.00
R8680:Casc1 UTSW 6 145181816 missense probably benign 0.13
R8720:Casc1 UTSW 6 145205257 missense unknown
R9118:Casc1 UTSW 6 145175245 missense probably damaging 1.00
R9172:Casc1 UTSW 6 145177449 missense probably benign
R9290:Casc1 UTSW 6 145202962 missense unknown
X0063:Casc1 UTSW 6 145175271 missense probably benign 0.13
Z1176:Casc1 UTSW 6 145205293 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTTAGCGGCTGACTGGAAAG -3'
(R):5'- TGTGTATGTTTGGCAATCCCAG -3'

Sequencing Primer
(F):5'- GGAAAGATACCTGATTCCTCTCGG -3'
(R):5'- GTTTGGCAATCCCAGAATTCACG -3'
Posted On 2021-12-30