Incidental Mutation 'R9169:Scarb1'
ID 696251
Institutional Source Beutler Lab
Gene Symbol Scarb1
Ensembl Gene ENSMUSG00000037936
Gene Name scavenger receptor class B, member 1
Synonyms Cd36l1, Srb1, Hdlq1, SRBI, Hlb398, Cla-1, SR-BI, D5Ertd460e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9169 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 125277087-125341094 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 125294082 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 309 (A309T)
Ref Sequence ENSEMBL: ENSMUSP00000083242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086075] [ENSMUST00000111390] [ENSMUST00000127148]
AlphaFold Q61009
PDB Structure Molecular analysis of the interaction of the HDL-receptor SR-BI with the PDZ3 domain of its adaptor protein PDZK1 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000086075
AA Change: A309T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083242
Gene: ENSMUSG00000037936
AA Change: A309T

DomainStartEndE-ValueType
Pfam:CD36 16 463 6.4e-154 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111390
AA Change: A309T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107021
Gene: ENSMUSG00000037936
AA Change: A309T

DomainStartEndE-ValueType
Pfam:CD36 14 465 4.7e-158 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000127148
AA Change: A10T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122100
Gene: ENSMUSG00000037936
AA Change: A10T

DomainStartEndE-ValueType
Pfam:CD36 1 123 1.2e-43 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (92/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plasma membrane receptor for high density lipoprotein cholesterol (HDL). The encoded protein mediates cholesterol transfer to and from HDL. In addition, this protein is a receptor for hepatitis C virus glycoprotein E2. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Targeted mutations result in abnormal lipoprotein metablolism and, for one allele, reversible female infertility. An ENU mutant shows increased cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A T 7: 41,611,685 probably benign Het
9230104L09Rik A G 2: 148,850,669 probably null Het
9330182O14Rik A T 15: 40,142,236 K17* probably null Het
Adamtsl3 A C 7: 82,573,980 I990L probably damaging Het
Add1 T A 5: 34,630,778 S724T possibly damaging Het
Afdn A G 17: 13,852,365 N865S probably benign Het
Amot A T X: 145,461,749 L435H Het
Ap1m2 T A 9: 21,312,227 I8F probably benign Het
Atp8a1 T C 5: 67,667,601 T811A Het
Axin2 A G 11: 108,931,552 D310G probably damaging Het
BC005561 T A 5: 104,518,482 L290H probably damaging Het
Bin1 T G 18: 32,429,198 F379L possibly damaging Het
Bin2 C A 15: 100,656,750 S91I possibly damaging Het
Birc5 A G 11: 117,852,773 N111S probably benign Het
Blk T A 14: 63,382,681 N137Y probably damaging Het
Cacna1d G A 14: 30,074,916 A1534V probably damaging Het
Cacna2d1 T C 5: 16,246,759 V207A probably damaging Het
Ccr3 A G 9: 124,028,912 I95V probably benign Het
Celsr2 T C 3: 108,402,546 D1579G probably benign Het
Cfap36 C A 11: 29,246,541 K19N probably benign Het
Cfap52 C T 11: 67,954,034 V70M possibly damaging Het
Chid1 A T 7: 141,513,809 I298N probably damaging Het
Clstn1 G T 4: 149,646,865 R888L possibly damaging Het
Col6a5 T A 9: 105,945,397 T254S unknown Het
Coro6 C T 11: 77,468,503 P301S probably damaging Het
Dchs1 T C 7: 105,772,907 D102G probably damaging Het
Dnah14 T C 1: 181,605,816 F353L probably benign Het
Dnajc10 A T 2: 80,332,971 I344L probably benign Het
Dst T C 1: 34,264,571 V4026A probably damaging Het
Exo1 A G 1: 175,887,637 E114G possibly damaging Het
Fabp7 A G 10: 57,786,343 I109V probably benign Het
Fars2 T C 13: 36,232,126 F206S probably damaging Het
Gbp8 C T 5: 105,031,289 A115T possibly damaging Het
Gm10767 T C 13: 66,907,999 F19L probably damaging Het
Gm17067 T C 7: 42,708,203 T292A probably benign Het
Gp2 T C 7: 119,442,706 D532G probably benign Het
Gtf2i C A 5: 134,242,680 A917S probably damaging Het
Guca1b A G 17: 47,391,902 E169G possibly damaging Het
Hdac1 A T 4: 129,534,706 Y24N probably damaging Het
Hepacam T C 9: 37,382,397 F251L probably damaging Het
Hmcn1 G T 1: 150,630,341 N3811K probably damaging Het
Htra4 A T 8: 25,030,117 M391K probably damaging Het
Ino80d T C 1: 63,058,771 T760A probably benign Het
Ints1 T G 5: 139,762,831 T1074P probably benign Het
Itga6 A T 2: 71,816,671 Q75L possibly damaging Het
Mapk14 A C 17: 28,741,840 N272T probably benign Het
Meikin A T 11: 54,394,691 T185S possibly damaging Het
Moxd2 C T 6: 40,883,556 G318D possibly damaging Het
Mtmr3 G A 11: 4,487,739 T905I probably benign Het
Muc16 A G 9: 18,656,528 I1565T unknown Het
Myh14 A G 7: 44,621,857 S1500P possibly damaging Het
Nfkb1 T C 3: 135,605,113 E475G probably benign Het
Ngef C A 1: 87,545,859 R67L probably benign Het
Olfr1489 A G 19: 13,633,539 I143V probably benign Het
Olfr273 T A 4: 52,856,052 I154F probably damaging Het
Olfr823 A C 10: 130,111,854 I312R probably benign Het
Olfr935 A G 9: 38,995,277 S53P probably benign Het
Olr1 T C 6: 129,493,565 E213G probably damaging Het
Pcdhga3 C T 18: 37,676,035 L514F probably damaging Het
Pcnt A G 10: 76,385,738 M2018T possibly damaging Het
Pde8a C T 7: 81,332,871 T746I probably damaging Het
Pik3ca T C 3: 32,449,606 probably null Het
Psapl1 A G 5: 36,205,536 S491G possibly damaging Het
Psmf1 A T 2: 151,735,537 D73E probably benign Het
Ptprcap A G 19: 4,156,359 D147G probably benign Het
Rdh8 T A 9: 20,825,639 V309E possibly damaging Het
Rhobtb3 T A 13: 75,893,002 T396S probably benign Het
Rpa1 A T 11: 75,310,173 L475* probably null Het
Rtkn T A 6: 83,152,209 S562T probably damaging Het
Scamp1 C T 13: 94,253,025 D35N probably benign Het
Scube1 G A 15: 83,659,097 T180M possibly damaging Het
Sez6 T G 11: 77,977,647 F945V probably damaging Het
Sf3a1 C T 11: 4,166,681 T124M probably benign Het
Smchd1 T C 17: 71,415,664 K759E probably damaging Het
Sort1 C A 3: 108,340,678 C446* probably null Het
Sun1 T A 5: 139,233,518 S360T probably benign Het
Supv3l1 A G 10: 62,432,459 F536L probably damaging Het
Taar6 A C 10: 23,985,375 V91G probably damaging Het
Tex45 A T 8: 3,475,967 Y40F possibly damaging Het
Themis C A 10: 28,782,237 T420N probably benign Het
Tmc2 T A 2: 130,241,596 I491N probably damaging Het
Trmt112 T C 19: 6,910,819 I113T probably damaging Het
Ttc14 C T 3: 33,802,922 Q183* probably null Het
Txndc16 T A 14: 45,135,928 D748V probably damaging Het
Xkr6 A G 14: 63,606,618 D30G possibly damaging Het
Zc3h14 C T 12: 98,779,246 S498L probably damaging Het
Zc3h7b A C 15: 81,776,983 D341A probably benign Het
Zfp108 T A 7: 24,261,498 C505S probably damaging Het
Zfp354c A C 11: 50,815,261 L329R probably damaging Het
Zfyve16 T A 13: 92,521,363 D680V probably damaging Het
Znfx1 A G 2: 167,055,265 F580L probably benign Het
Other mutations in Scarb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03355:Scarb1 APN 5 125289702 missense probably benign 0.01
IGL03052:Scarb1 UTSW 5 125294099 missense probably damaging 1.00
R0051:Scarb1 UTSW 5 125281100 splice site probably null
R0317:Scarb1 UTSW 5 125289692 missense probably damaging 0.99
R0455:Scarb1 UTSW 5 125289681 missense probably damaging 0.96
R0491:Scarb1 UTSW 5 125298731 unclassified probably benign
R0655:Scarb1 UTSW 5 125300440 missense probably damaging 1.00
R0676:Scarb1 UTSW 5 125297214 unclassified probably benign
R2074:Scarb1 UTSW 5 125294143 missense probably benign
R2267:Scarb1 UTSW 5 125287375 missense possibly damaging 0.82
R3951:Scarb1 UTSW 5 125287411 missense probably damaging 0.99
R4080:Scarb1 UTSW 5 125277795 missense probably damaging 1.00
R4452:Scarb1 UTSW 5 125300345 missense probably damaging 1.00
R4925:Scarb1 UTSW 5 125297299 missense probably damaging 1.00
R5669:Scarb1 UTSW 5 125300387 missense probably damaging 1.00
R5809:Scarb1 UTSW 5 125304222 missense probably damaging 0.98
R5872:Scarb1 UTSW 5 125304277 missense possibly damaging 0.60
R5883:Scarb1 UTSW 5 125340907 unclassified probably benign
R6321:Scarb1 UTSW 5 125304331 missense probably damaging 1.00
R6508:Scarb1 UTSW 5 125304325 missense possibly damaging 0.49
R6618:Scarb1 UTSW 5 125304330 missense probably damaging 0.96
R6931:Scarb1 UTSW 5 125284719 missense probably damaging 1.00
R7058:Scarb1 UTSW 5 125297230 missense probably damaging 1.00
R7099:Scarb1 UTSW 5 125304350 missense probably damaging 0.98
R7146:Scarb1 UTSW 5 125284025 missense probably benign
R7830:Scarb1 UTSW 5 125287383 missense probably damaging 1.00
R7873:Scarb1 UTSW 5 125294039 missense probably damaging 1.00
R8158:Scarb1 UTSW 5 125303137 missense probably benign 0.01
R8467:Scarb1 UTSW 5 125298667 missense probably damaging 0.99
R8500:Scarb1 UTSW 5 125294163 missense probably damaging 1.00
R8814:Scarb1 UTSW 5 125294092 missense probably benign 0.00
R9025:Scarb1 UTSW 5 125304350 missense probably damaging 0.98
R9462:Scarb1 UTSW 5 125340827 missense probably damaging 1.00
R9685:Scarb1 UTSW 5 125294130 missense possibly damaging 0.49
R9699:Scarb1 UTSW 5 125297232 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGATCATCATGGGTGCAGAG -3'
(R):5'- GTTTCCTCAGCAACAGGTGAC -3'

Sequencing Primer
(F):5'- TCATCATGGGTGCAGAGACCAG -3'
(R):5'- TTCCTCAGCAACAGGTGACTAGTG -3'
Posted On 2022-02-07