Incidental Mutation 'R9177:Acap2'
ID 696782
Institutional Source Beutler Lab
Gene Symbol Acap2
Ensembl Gene ENSMUSG00000049076
Gene Name ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
Synonyms Centb2, 9530039J15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock # R9177 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 31092412-31201245 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 31136574 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 161 (V161E)
Ref Sequence ENSEMBL: ENSMUSP00000061501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058033] [ENSMUST00000229010] [ENSMUST00000230614] [ENSMUST00000230698] [ENSMUST00000231125]
AlphaFold Q6ZQK5
Predicted Effect probably damaging
Transcript: ENSMUST00000058033
AA Change: V161E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061501
Gene: ENSMUSG00000049076
AA Change: V161E

DomainStartEndE-ValueType
Pfam:BAR_3 5 238 9.1e-96 PFAM
PH 267 363 1.73e-17 SMART
ArfGap 399 520 2.23e-63 SMART
ANK 632 661 6.71e-2 SMART
ANK 665 694 3.04e0 SMART
ANK 698 727 6.64e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000229010
AA Change: V179E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000230614
AA Change: V179E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000230698
Predicted Effect probably damaging
Transcript: ENSMUST00000231125
AA Change: V179E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,069,916 V1622D probably damaging Het
Acadsb C T 7: 131,432,034 T260I probably damaging Het
Alk T C 17: 71,874,195 T1367A probably damaging Het
Atg2a A C 19: 6,241,875 H27P probably damaging Het
Atp2c1 C T 9: 105,459,659 probably null Het
C1s1 T G 6: 124,531,403 K542N probably damaging Het
Camk1d A G 2: 5,299,090 S351P probably benign Het
Carf C A 1: 60,109,399 Q85K possibly damaging Het
Caskin2 T C 11: 115,807,857 N43S probably damaging Het
Cd40 T C 2: 165,063,545 C161R probably damaging Het
Cdh19 A G 1: 110,949,381 F76S probably damaging Het
Cdkl1 T C 12: 69,747,326 N346D probably benign Het
Cdon A G 9: 35,469,934 D540G probably benign Het
Cep164 T A 9: 45,779,762 E379V probably damaging Het
Clock T C 5: 76,229,409 N681S probably benign Het
Col15a1 G C 4: 47,288,200 probably benign Het
Col6a5 T G 9: 105,930,953 K965N unknown Het
Dctn4 T A 18: 60,526,232 M1K probably null Het
Dhx30 T C 9: 110,086,682 D741G probably damaging Het
Dhx37 A G 5: 125,430,894 V104A probably benign Het
Dnah12 A G 14: 26,849,298 K2788R possibly damaging Het
Egfr T A 11: 16,905,410 D898E probably damaging Het
Eif2ak4 G C 2: 118,441,220 probably null Het
Eif6 A G 2: 155,823,932 L101P probably damaging Het
Etaa1 A T 11: 17,946,419 V566E probably damaging Het
Fam126b T C 1: 58,552,202 D94G probably damaging Het
Far2 C T 6: 148,158,920 T257I probably benign Het
Fuca2 G A 10: 13,514,819 W453* probably null Het
Galntl6 A T 8: 57,857,556 Y370* probably null Het
Gcn1l1 T C 5: 115,581,808 V374A probably benign Het
Gm11238 T C 4: 73,657,136 S351P probably damaging Het
Gm884 T A 11: 103,617,437 H1235L unknown Het
Hfe2 T C 3: 96,528,565 F380L probably benign Het
Ifi202b A T 1: 173,977,383 M1K probably null Het
Lama4 A G 10: 39,074,692 Y997C probably damaging Het
Lepr T A 4: 101,745,601 C195* probably null Het
Lrrc73 T C 17: 46,254,609 S89P probably benign Het
Macf1 T C 4: 123,473,789 E2393G probably damaging Het
Mdga2 T A 12: 66,470,707 T118S possibly damaging Het
Mtf2 A G 5: 108,087,083 K124R probably benign Het
Muc5b T C 7: 141,845,338 Y339H unknown Het
Nes G A 3: 87,979,705 G1757E probably damaging Het
Nfatc4 A T 14: 55,827,228 I391F probably damaging Het
Nup93 A T 8: 94,227,743 I23F probably benign Het
Olfr1197 A C 2: 88,728,830 Y256* probably null Het
Olfr1499 A T 19: 13,815,024 C189S probably damaging Het
Olfr183 T G 16: 58,999,720 F12V probably damaging Het
Olfr220 A C 1: 174,449,357 T245P probably damaging Het
Olfr828 G T 9: 18,815,446 Q283K probably damaging Het
Pak7 A C 2: 136,101,206 M338R probably benign Het
Papola A G 12: 105,799,773 E44G probably benign Het
Pcdh15 A T 10: 74,643,623 E522V probably benign Het
Peli2 A G 14: 48,281,470 E225G probably benign Het
Pla2g1b T G 5: 115,474,536 I117S probably damaging Het
Plxnd1 G T 6: 115,966,508 Q1246K probably benign Het
Pole A G 5: 110,332,422 E1953G probably benign Het
Pus7l T C 15: 94,533,564 I395V probably benign Het
Shisa7 T G 7: 4,834,334 D244A probably damaging Het
Slco3a1 T C 7: 74,303,198 T538A probably benign Het
Syk T A 13: 52,612,444 N188K probably benign Het
Tcf20 A G 15: 82,856,504 S249P probably benign Het
Tmem25 T C 9: 44,798,232 T91A possibly damaging Het
Trank1 T C 9: 111,392,511 V2772A probably benign Het
Ttn A T 2: 76,766,103 Y20155* probably null Het
Uchl4 C T 9: 64,235,704 H156Y probably benign Het
Ulbp1 A T 10: 7,446,392 L295Q unknown Het
Vwf G A 6: 125,604,291 A631T Het
Zfp810 C T 9: 22,278,640 C324Y probably damaging Het
Zswim8 T C 14: 20,711,840 L227P probably damaging Het
Other mutations in Acap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Acap2 APN 16 31139475 missense probably damaging 1.00
IGL01330:Acap2 APN 16 31154677 missense probably damaging 1.00
IGL01420:Acap2 APN 16 31101819 splice site probably benign
IGL02064:Acap2 APN 16 31127328 missense probably damaging 1.00
IGL02173:Acap2 APN 16 31108147 missense possibly damaging 0.68
IGL02453:Acap2 APN 16 31131257 splice site probably null
IGL02883:Acap2 APN 16 31096345 unclassified probably benign
IGL03203:Acap2 APN 16 31096345 unclassified probably benign
IGL03342:Acap2 APN 16 31105492 missense probably damaging 1.00
R1251:Acap2 UTSW 16 31108171 missense probably damaging 1.00
R1377:Acap2 UTSW 16 31116051 missense probably damaging 1.00
R1432:Acap2 UTSW 16 31111083 missense probably damaging 1.00
R1546:Acap2 UTSW 16 31104936 nonsense probably null
R1594:Acap2 UTSW 16 31127387 missense probably benign 0.01
R1829:Acap2 UTSW 16 31110934 missense probably damaging 1.00
R1853:Acap2 UTSW 16 31117304 missense probably damaging 1.00
R1970:Acap2 UTSW 16 31133527 critical splice donor site probably null
R2023:Acap2 UTSW 16 31119415 missense probably damaging 0.99
R2086:Acap2 UTSW 16 31110945 missense probably damaging 1.00
R2145:Acap2 UTSW 16 31105524 missense probably benign
R2177:Acap2 UTSW 16 31133528 critical splice donor site probably null
R2214:Acap2 UTSW 16 31108128 missense probably benign 0.19
R2392:Acap2 UTSW 16 31139640 missense probably damaging 0.99
R2438:Acap2 UTSW 16 31117315 missense probably damaging 1.00
R2913:Acap2 UTSW 16 31116069 missense probably damaging 0.99
R4207:Acap2 UTSW 16 31119427 missense probably damaging 0.99
R4274:Acap2 UTSW 16 31108114 missense probably benign 0.01
R4814:Acap2 UTSW 16 31108126 missense probably benign
R4860:Acap2 UTSW 16 31103499 missense possibly damaging 0.92
R4860:Acap2 UTSW 16 31103499 missense possibly damaging 0.92
R5310:Acap2 UTSW 16 31133609 missense probably benign 0.00
R5345:Acap2 UTSW 16 31108126 missense probably benign
R5388:Acap2 UTSW 16 31109725 missense probably damaging 1.00
R5551:Acap2 UTSW 16 31104908 missense probably damaging 1.00
R5578:Acap2 UTSW 16 31108114 missense probably benign 0.00
R6341:Acap2 UTSW 16 31105546 missense possibly damaging 0.86
R6659:Acap2 UTSW 16 31131315 missense probably damaging 0.99
R6977:Acap2 UTSW 16 31117261 missense probably damaging 1.00
R7262:Acap2 UTSW 16 31127319 critical splice donor site probably null
R7304:Acap2 UTSW 16 31108116 missense probably benign 0.05
R7310:Acap2 UTSW 16 31108154 nonsense probably null
R7318:Acap2 UTSW 16 31127337 missense probably damaging 1.00
R7514:Acap2 UTSW 16 31154567 splice site probably null
R7875:Acap2 UTSW 16 31139641 missense probably damaging 0.99
R8256:Acap2 UTSW 16 31139469 critical splice donor site probably null
R9026:Acap2 UTSW 16 31107088 missense probably damaging 0.99
R9252:Acap2 UTSW 16 31101823 critical splice donor site probably null
R9268:Acap2 UTSW 16 31136574 missense probably damaging 1.00
R9329:Acap2 UTSW 16 31127420 missense probably damaging 1.00
R9467:Acap2 UTSW 16 31111083 missense possibly damaging 0.54
R9528:Acap2 UTSW 16 31111090 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CTGTCTTTGTGAAGCAGGCC -3'
(R):5'- CTGTAATCTGCAGGACCGAC -3'

Sequencing Primer
(F):5'- CTTTGTGAAGCAGGCCATAAGTTAGC -3'
(R):5'- TAATCTGCAGGACCGACCAGTG -3'
Posted On 2022-02-07