Incidental Mutation 'R9186:Tnrc18'
ID 697368
Institutional Source Beutler Lab
Gene Symbol Tnrc18
Ensembl Gene ENSMUSG00000039477
Gene Name trinucleotide repeat containing 18
Synonyms Zfp469, EG381742
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.710) question?
Stock # R9186 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 142724661-142817662 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 142787733 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 447 (N447S)
Ref Sequence ENSEMBL: ENSMUSP00000114769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151477] [ENSMUST00000152247]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000114769
Gene: ENSMUSG00000039477
AA Change: N447S

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
low complexity region 240 287 N/A INTRINSIC
low complexity region 369 390 N/A INTRINSIC
low complexity region 457 475 N/A INTRINSIC
low complexity region 623 634 N/A INTRINSIC
coiled coil region 843 876 N/A INTRINSIC
low complexity region 916 930 N/A INTRINSIC
low complexity region 951 970 N/A INTRINSIC
low complexity region 980 993 N/A INTRINSIC
low complexity region 1093 1112 N/A INTRINSIC
low complexity region 1269 1289 N/A INTRINSIC
coiled coil region 1411 1443 N/A INTRINSIC
low complexity region 1477 1493 N/A INTRINSIC
low complexity region 1581 1593 N/A INTRINSIC
low complexity region 1608 1619 N/A INTRINSIC
low complexity region 1735 1752 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000152247
AA Change: N264S
SMART Domains Protein: ENSMUSP00000117651
Gene: ENSMUSG00000039477
AA Change: N264S

DomainStartEndE-ValueType
low complexity region 57 104 N/A INTRINSIC
low complexity region 186 207 N/A INTRINSIC
low complexity region 274 292 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
coiled coil region 660 693 N/A INTRINSIC
low complexity region 733 747 N/A INTRINSIC
low complexity region 768 787 N/A INTRINSIC
low complexity region 797 810 N/A INTRINSIC
low complexity region 910 929 N/A INTRINSIC
low complexity region 1086 1106 N/A INTRINSIC
coiled coil region 1228 1260 N/A INTRINSIC
low complexity region 1294 1310 N/A INTRINSIC
low complexity region 1398 1410 N/A INTRINSIC
low complexity region 1425 1436 N/A INTRINSIC
coiled coil region 1570 1592 N/A INTRINSIC
low complexity region 1606 1618 N/A INTRINSIC
low complexity region 1622 1640 N/A INTRINSIC
low complexity region 1641 1653 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik C A 9: 57,257,189 R634L probably damaging Het
Ankhd1 T C 18: 36,634,330 I210T possibly damaging Het
Ankle2 G A 5: 110,252,744 V649M possibly damaging Het
Arid3b A T 9: 57,794,934 probably null Het
Arl10 A G 13: 54,578,807 N133D probably damaging Het
Bag6 C T 17: 35,144,691 R784W probably damaging Het
Ccnl1 T C 3: 65,958,005 T42A unknown Het
Cd164 C A 10: 41,528,699 P151Q probably damaging Het
Cdh23 G A 10: 60,307,527 A3005V possibly damaging Het
Ceacam2 T A 7: 25,527,788 N218I probably damaging Het
Cfap97 C T 8: 46,191,628 R466C possibly damaging Het
Colgalt2 C A 1: 152,508,652 T581K probably damaging Het
Dnah11 T A 12: 118,190,897 D216V probably benign Het
Dusp13 A T 14: 21,748,495 S34T probably damaging Het
Esf1 T A 2: 140,148,872 K564I possibly damaging Het
F5 A G 1: 164,193,901 N1315S probably benign Het
Fubp1 A T 3: 152,220,516 M292L probably damaging Het
Gabrb2 A T 11: 42,487,373 M139L possibly damaging Het
Gk5 T A 9: 96,133,416 V95D probably benign Het
Glcci1 C A 6: 8,537,826 P148Q possibly damaging Het
Gm19410 A T 8: 35,815,475 S1952C possibly damaging Het
Gstm4 T C 3: 108,044,733 probably benign Het
Heatr1 T A 13: 12,421,346 L1211Q probably damaging Het
Helz2 A G 2: 181,234,664 S1346P possibly damaging Het
Hexb A C 13: 97,189,328 V158G probably damaging Het
Hipk3 T C 2: 104,471,094 E251G probably damaging Het
Hps5 T C 7: 46,788,946 Y89C probably damaging Het
Iqub A T 6: 24,450,767 V611D possibly damaging Het
Itgbl1 G A 14: 123,857,558 D332N probably benign Het
Krtap26-1 C A 16: 88,647,721 R4L unknown Het
Lgi3 A G 14: 70,534,753 Y246C probably damaging Het
Mug2 T A 6: 122,075,289 I1002N probably damaging Het
Myo18a C T 11: 77,859,021 T66M Het
Naip6 T C 13: 100,299,882 D711G possibly damaging Het
Olfr1312 C A 2: 112,042,750 C94F probably damaging Het
Orc5 T A 5: 22,547,946 Q48L probably benign Het
Oxct2a C A 4: 123,322,668 A307S probably damaging Het
Pgls T C 8: 71,596,189 *258Q probably null Het
Plekha6 C T 1: 133,292,433 R955W probably damaging Het
Polr1c G T 17: 46,245,707 N97K probably damaging Het
Prr27 C A 5: 87,843,135 P202Q probably benign Het
Prtg T C 9: 72,856,877 V544A probably benign Het
Rbl2 G A 8: 91,101,378 G574S probably damaging Het
Scamp1 T A 13: 94,208,174 T272S possibly damaging Het
Sun2 T A 15: 79,727,536 D562V probably damaging Het
Szt2 A G 4: 118,385,091 F1565S probably damaging Het
Tatdn2 C T 6: 113,710,164 R779C probably benign Het
Tbc1d30 T C 10: 121,275,734 I430V probably benign Het
Tmem86b T C 7: 4,629,726 D43G probably damaging Het
Trmt2a T C 16: 18,251,169 S292P probably benign Het
Trpc2 T C 7: 102,088,285 V428A probably damaging Het
Tsc2 T C 17: 24,604,888 E981G probably damaging Het
Ucp1 G T 8: 83,290,643 G21* probably null Het
Utrn T C 10: 12,614,574 T21A probably benign Het
Vapa A T 17: 65,593,512 N88K probably damaging Het
Wasl T C 6: 24,664,616 R10G probably damaging Het
Zan C A 5: 137,393,548 V4662F unknown Het
Zap70 G A 1: 36,779,751 M382I possibly damaging Het
Zdhhc17 T C 10: 110,944,420 I624M probably benign Het
Other mutations in Tnrc18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Tnrc18 APN 5 142763037 missense unknown
IGL01732:Tnrc18 APN 5 142772061 missense unknown
IGL01796:Tnrc18 APN 5 142764887 missense possibly damaging 0.88
IGL01868:Tnrc18 APN 5 142771812 missense unknown
IGL02010:Tnrc18 APN 5 142787294 missense unknown
IGL02566:Tnrc18 APN 5 142772313 splice site probably benign
IGL02688:Tnrc18 APN 5 142790172 missense probably damaging 0.96
IGL03052:Tnrc18 UTSW 5 142775219 missense unknown
R0129:Tnrc18 UTSW 5 142765045 splice site probably benign
R0617:Tnrc18 UTSW 5 142776739 missense unknown
R0894:Tnrc18 UTSW 5 142815114 missense probably benign 0.37
R1056:Tnrc18 UTSW 5 142773859 nonsense probably null
R1084:Tnrc18 UTSW 5 142764767 critical splice donor site probably null
R1131:Tnrc18 UTSW 5 142787208 missense unknown
R1411:Tnrc18 UTSW 5 142765947 missense unknown
R1443:Tnrc18 UTSW 5 142771533 missense unknown
R1681:Tnrc18 UTSW 5 142773817 missense unknown
R1698:Tnrc18 UTSW 5 142788703 missense possibly damaging 0.83
R1795:Tnrc18 UTSW 5 142815114 missense probably benign 0.37
R1903:Tnrc18 UTSW 5 142815140 missense probably damaging 0.99
R1930:Tnrc18 UTSW 5 142776324 missense unknown
R1931:Tnrc18 UTSW 5 142776324 missense unknown
R1941:Tnrc18 UTSW 5 142815150 missense probably damaging 1.00
R2069:Tnrc18 UTSW 5 142766087 missense unknown
R2074:Tnrc18 UTSW 5 142759706 splice site probably null
R2089:Tnrc18 UTSW 5 142773641 missense unknown
R2091:Tnrc18 UTSW 5 142773641 missense unknown
R2091:Tnrc18 UTSW 5 142773641 missense unknown
R2182:Tnrc18 UTSW 5 142760061 missense unknown
R2190:Tnrc18 UTSW 5 142775889 missense unknown
R2310:Tnrc18 UTSW 5 142788553 missense probably damaging 0.96
R2372:Tnrc18 UTSW 5 142759704 splice site probably benign
R2445:Tnrc18 UTSW 5 142772115 missense unknown
R3806:Tnrc18 UTSW 5 142787274 missense unknown
R4097:Tnrc18 UTSW 5 142773806 small deletion probably benign
R4153:Tnrc18 UTSW 5 142765992 missense possibly damaging 0.89
R4274:Tnrc18 UTSW 5 142743650 missense unknown
R4520:Tnrc18 UTSW 5 142732150 missense unknown
R4627:Tnrc18 UTSW 5 142740128 missense unknown
R4852:Tnrc18 UTSW 5 142731340 missense probably damaging 0.98
R4873:Tnrc18 UTSW 5 142765177 missense unknown
R4875:Tnrc18 UTSW 5 142765177 missense unknown
R4876:Tnrc18 UTSW 5 142731625 missense unknown
R4936:Tnrc18 UTSW 5 142765977 nonsense probably null
R4942:Tnrc18 UTSW 5 142787982 missense unknown
R4962:Tnrc18 UTSW 5 142739493 missense unknown
R5373:Tnrc18 UTSW 5 142740156 missense unknown
R5374:Tnrc18 UTSW 5 142740156 missense unknown
R5454:Tnrc18 UTSW 5 142771691 missense unknown
R5678:Tnrc18 UTSW 5 142733564 missense unknown
R5826:Tnrc18 UTSW 5 142773747 missense unknown
R5891:Tnrc18 UTSW 5 142815171 missense probably damaging 0.99
R6195:Tnrc18 UTSW 5 142765173 missense unknown
R6296:Tnrc18 UTSW 5 142733576 missense unknown
R6358:Tnrc18 UTSW 5 142727981 missense probably damaging 0.99
R6452:Tnrc18 UTSW 5 142727012 missense probably damaging 1.00
R6498:Tnrc18 UTSW 5 142732168 missense unknown
R6711:Tnrc18 UTSW 5 142787790 missense unknown
R6782:Tnrc18 UTSW 5 142787308 missense unknown
R6863:Tnrc18 UTSW 5 142815197 missense probably damaging 1.00
R6894:Tnrc18 UTSW 5 142760049 missense unknown
R6970:Tnrc18 UTSW 5 142727989 missense probably damaging 0.99
R7053:Tnrc18 UTSW 5 142787229 missense unknown
R7135:Tnrc18 UTSW 5 142787817 missense
R7756:Tnrc18 UTSW 5 142787152 missense
R7902:Tnrc18 UTSW 5 142772147 missense
R8039:Tnrc18 UTSW 5 142732052 missense unknown
R8053:Tnrc18 UTSW 5 142750630 missense unknown
R8322:Tnrc18 UTSW 5 142726012 missense probably damaging 1.00
R8379:Tnrc18 UTSW 5 142788402 missense
R8745:Tnrc18 UTSW 5 142787447 missense
R8837:Tnrc18 UTSW 5 142793056 missense possibly damaging 0.94
R8894:Tnrc18 UTSW 5 142739457 missense unknown
R8909:Tnrc18 UTSW 5 142776376 missense
R9030:Tnrc18 UTSW 5 142726063 missense probably damaging 1.00
R9189:Tnrc18 UTSW 5 142731352 missense probably damaging 1.00
R9192:Tnrc18 UTSW 5 142787847 missense
R9227:Tnrc18 UTSW 5 142787637 missense
R9230:Tnrc18 UTSW 5 142787637 missense
RF022:Tnrc18 UTSW 5 142773630 missense
Z1177:Tnrc18 UTSW 5 142773888 missense
Predicted Primers PCR Primer
(F):5'- CTGTATTTGATGAGGCTCTGCATAGC -3'
(R):5'- GGAGAAAAGCTCGGTCATCC -3'

Sequencing Primer
(F):5'- TGCATAGCAGAGGCCTCTC -3'
(R):5'- GGTCATCCGCTCCCTCAAG -3'
Posted On 2022-02-07