Incidental Mutation 'R9194:Itgb5'
ID 697879
Institutional Source Beutler Lab
Gene Symbol Itgb5
Ensembl Gene ENSMUSG00000022817
Gene Name integrin beta 5
Synonyms ESTM23, [b]-5, beta-5, beta5, [b]5, [b]5A, [b]5B
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9194 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 33829665-33949338 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 33900511 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 315 (D315G)
Ref Sequence ENSEMBL: ENSMUSP00000069416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069345] [ENSMUST00000115028] [ENSMUST00000232262]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000069345
AA Change: D315G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069416
Gene: ENSMUSG00000022817
AA Change: D315G

DomainStartEndE-ValueType
PSI 27 76 1.4e-7 SMART
INB 35 463 1.18e-284 SMART
VWA 137 372 5.95e-7 SMART
internal_repeat_1 492 549 3.16e-7 PROSPERO
EGF 554 586 1.95e1 SMART
Integrin_B_tail 635 719 1.56e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115028
AA Change: D315G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110680
Gene: ENSMUSG00000022817
AA Change: D315G

DomainStartEndE-ValueType
PSI 27 76 1.4e-7 SMART
INB 35 463 1.18e-284 SMART
VWA 137 372 5.95e-7 SMART
internal_repeat_1 492 549 3.16e-7 PROSPERO
EGF 554 586 1.95e1 SMART
Integrin_B_tail 635 719 1.56e-21 SMART
Integrin_b_cyt 743 790 5.97e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000232262
AA Change: D2G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 94% (44/47)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation do not appear to differ from normal in respect to development, reproduction, adenovirus infection, or wound healing. Mutant keratinocytes do show reduced migration on, and adhesion to, vitronectin in vitro. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,259,088 M1K probably null Het
Adra1b A T 11: 43,835,436 V218D probably damaging Het
Ank1 A G 8: 23,116,239 S1216G possibly damaging Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Cfap44 G T 16: 44,468,461 D1525Y probably damaging Het
Chd8 A T 14: 52,202,193 M2341K probably benign Het
Chst11 A G 10: 83,191,485 T249A probably damaging Het
Cttnbp2 A G 6: 18,434,851 V336A probably benign Het
Dennd3 T C 15: 73,547,304 L648P probably benign Het
Dgcr14 A T 16: 17,910,164 D79E probably damaging Het
Dhx16 T C 17: 35,889,281 V864A probably benign Het
Enpp3 G A 10: 24,799,194 H362Y possibly damaging Het
Fam83c T A 2: 155,829,379 Y712F probably damaging Het
Helz C T 11: 107,670,287 Q1392* probably null Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Iqch T C 9: 63,572,679 H143R probably benign Het
Kcnmb2 A G 3: 32,182,025 K141R probably benign Het
Lrrc37a G A 11: 103,500,850 P1250S probably benign Het
Mcm5 T G 8: 75,110,334 V110G probably damaging Het
Med27 G A 2: 29,471,300 D163N probably damaging Het
Mms22l C A 4: 24,600,185 Y1129* probably null Het
Mov10l1 G A 15: 89,046,820 R1081H probably damaging Het
Mtpap C G 18: 4,380,833 N170K probably benign Het
Mtpap C T 18: 4,380,834 Q171* probably null Het
Myo6 T A 9: 80,246,554 F271I unknown Het
Ndst4 C T 3: 125,724,736 S354L probably benign Het
Nfatc1 C T 18: 80,708,043 A26T probably benign Het
Olfr867 C A 9: 20,055,247 C72F probably damaging Het
Piezo2 G C 18: 63,117,744 T428S probably benign Het
Prkch A G 12: 73,721,842 E462G probably damaging Het
Rbm20 A G 19: 53,834,700 Y576C probably damaging Het
Riok3 TTTCATT TTT 18: 12,149,585 probably null Het
Rpp40 C T 13: 35,896,915 D302N probably benign Het
Sash1 A G 10: 8,740,205 V631A probably damaging Het
Sstr2 A G 11: 113,624,377 T41A probably benign Het
Thsd7b T A 1: 129,915,634 V861E possibly damaging Het
Tomm70a A G 16: 57,152,707 K603E possibly damaging Het
Tpd52l2 T A 2: 181,499,890 M22K possibly damaging Het
Tpst1 T A 5: 130,102,019 L110Q possibly damaging Het
Tram1l1 A G 3: 124,321,488 Y99C possibly damaging Het
Ttc39b A G 4: 83,263,740 F81L possibly damaging Het
Ubr1 A G 2: 120,947,844 Y238H probably damaging Het
Vmn1r202 G T 13: 22,502,146 H34N possibly damaging Het
Vmn1r36 G A 6: 66,716,052 Q280* probably null Het
Xpnpep1 A T 19: 53,011,858 V187E possibly damaging Het
Zfp592 A G 7: 81,024,601 I438V probably benign Het
Other mutations in Itgb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Itgb5 APN 16 33884975 missense probably damaging 1.00
IGL01121:Itgb5 APN 16 33919989 missense probably benign 0.00
IGL01620:Itgb5 APN 16 33919798 missense probably damaging 1.00
IGL02332:Itgb5 APN 16 33920130 nonsense probably null
IGL02869:Itgb5 APN 16 33844992 missense possibly damaging 0.94
IGL02881:Itgb5 APN 16 33919905 missense probably benign 0.00
IGL02941:Itgb5 APN 16 33944095 splice site probably benign
IGL03216:Itgb5 APN 16 33902838 missense probably benign 0.38
IGL03351:Itgb5 APN 16 33910552 missense probably benign 0.00
PIT4812001:Itgb5 UTSW 16 33919987 missense probably damaging 1.00
R0744:Itgb5 UTSW 16 33900583 missense probably damaging 0.99
R0829:Itgb5 UTSW 16 33944201 missense probably benign 0.29
R0836:Itgb5 UTSW 16 33900583 missense probably damaging 0.99
R1387:Itgb5 UTSW 16 33900515 nonsense probably null
R1703:Itgb5 UTSW 16 33910500 missense probably benign 0.01
R1783:Itgb5 UTSW 16 33940562 missense probably benign 0.13
R1826:Itgb5 UTSW 16 33865560 missense possibly damaging 0.48
R1889:Itgb5 UTSW 16 33910469 missense probably damaging 1.00
R2374:Itgb5 UTSW 16 33919798 missense probably damaging 1.00
R4307:Itgb5 UTSW 16 33948732 missense possibly damaging 0.80
R4355:Itgb5 UTSW 16 33844997 missense probably damaging 0.98
R4796:Itgb5 UTSW 16 33885021 missense possibly damaging 0.83
R4879:Itgb5 UTSW 16 33875978 missense probably damaging 1.00
R6165:Itgb5 UTSW 16 33899242 missense probably benign 0.01
R6584:Itgb5 UTSW 16 33885030 missense probably damaging 1.00
R6617:Itgb5 UTSW 16 33946592 missense probably benign 0.01
R6748:Itgb5 UTSW 16 33899297 missense probably damaging 1.00
R6979:Itgb5 UTSW 16 33919986 missense probably damaging 1.00
R7090:Itgb5 UTSW 16 33885094 missense probably damaging 1.00
R7150:Itgb5 UTSW 16 33940643 missense probably benign 0.03
R7403:Itgb5 UTSW 16 33902793 critical splice acceptor site probably null
R7418:Itgb5 UTSW 16 33885094 missense probably damaging 1.00
R7719:Itgb5 UTSW 16 33920116 missense probably benign 0.01
R8309:Itgb5 UTSW 16 33865553 missense probably benign 0.00
R8347:Itgb5 UTSW 16 33940678 missense probably damaging 1.00
R8856:Itgb5 UTSW 16 33900592 missense probably damaging 1.00
R9100:Itgb5 UTSW 16 33920181 missense possibly damaging 0.91
R9309:Itgb5 UTSW 16 33920046 missense probably benign 0.00
R9343:Itgb5 UTSW 16 33910456 splice site probably benign
R9629:Itgb5 UTSW 16 33875925 missense probably damaging 1.00
R9683:Itgb5 UTSW 16 33919965 missense probably damaging 0.97
R9710:Itgb5 UTSW 16 33865547 missense probably benign 0.00
X0022:Itgb5 UTSW 16 33845050 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TAACGAATGTCCTTTCCTATAGCC -3'
(R):5'- ATGAGTCACGGATCAGACCAC -3'

Sequencing Primer
(F):5'- CCTTTCCTATAGCCTCTTAGATGAG -3'
(R):5'- CACACACTCACACATACTCTCG -3'
Posted On 2022-02-07