Incidental Mutation 'R9220:Grid2'
ID 699398
Institutional Source Beutler Lab
Gene Symbol Grid2
Ensembl Gene ENSMUSG00000071424
Gene Name glutamate receptor, ionotropic, delta 2
Synonyms tpr, B230104L07Rik, GluRdelta2
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9220 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 63232860-64681307 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 63885888 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 95 (S95C)
Ref Sequence ENSEMBL: ENSMUSP00000093536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095852]
AlphaFold Q61625
Predicted Effect probably damaging
Transcript: ENSMUST00000095852
AA Change: S95C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093536
Gene: ENSMUSG00000071424
AA Change: S95C

DomainStartEndE-ValueType
Pfam:ANF_receptor 39 404 4.1e-41 PFAM
PBPe 442 807 5.98e-108 SMART
Lig_chan-Glu_bd 452 514 3.76e-24 SMART
transmembrane domain 830 852 N/A INTRINSIC
low complexity region 945 956 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the family of ionotropic glutamate receptors which are the predominant excitatory neurotransmitter receptors in the mammalian brain. The encoded protein is a multi-pass membrane protein that is expressed selectively in cerebellar Purkinje cells. A point mutation in the mouse ortholog, associated with the phenotype named 'lurcher', in the heterozygous state leads to ataxia resulting from selective, cell-autonomous apoptosis of cerebellar Purkinje cells during postnatal development. Mice homozygous for this mutation die shortly after birth from massive loss of mid- and hindbrain neurons during late embryogenesis. This protein also plays a role in synapse organization between parallel fibers and Purkinje cells. Alternate splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause cerebellar ataxia in humans. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for multiple spontaneous and targeted null mutations exhibit ataxia and impaired locomotion associated with cerebellar Purkinje cell abnormalities and loss, and on some backgrounds, male infertility due to lack of zona penetration by sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acte1 G T 7: 143,434,902 (GRCm39) probably null Het
Afg3l2 T G 18: 67,562,266 (GRCm39) I270L probably benign Het
Akap6 A T 12: 53,187,232 (GRCm39) I1549F possibly damaging Het
Ank2 T C 3: 126,737,086 (GRCm39) T2933A unknown Het
Atp1a3 C A 7: 24,696,625 (GRCm39) E309* probably null Het
B4galt2 T C 4: 117,734,399 (GRCm39) Y250C probably damaging Het
Bcl2l13 C A 6: 120,847,735 (GRCm39) T129K possibly damaging Het
Bltp3b A T 10: 89,626,457 (GRCm39) T384S probably benign Het
Clp1 A T 2: 84,554,076 (GRCm39) H364Q probably damaging Het
Ddx27 T C 2: 166,871,433 (GRCm39) V510A probably benign Het
Dicer1 A G 12: 104,679,415 (GRCm39) C521R probably damaging Het
Dnah10 A T 5: 124,871,437 (GRCm39) I2486F probably benign Het
Eml1 C A 12: 108,480,702 (GRCm39) C389* probably null Het
Fabp6 C T 11: 43,489,572 (GRCm39) G23D probably benign Het
Fam3b A T 16: 97,302,111 (GRCm39) S38T probably benign Het
Fsd1l A T 4: 53,679,799 (GRCm39) K166* probably null Het
Galc A G 12: 98,220,523 (GRCm39) S115P probably damaging Het
Gpn1 G A 5: 31,664,884 (GRCm39) A303T probably benign Het
Helz T A 11: 107,560,873 (GRCm39) S1312T probably benign Het
Matn2 T C 15: 34,410,325 (GRCm39) F506L possibly damaging Het
Mcemp1 A G 8: 3,717,512 (GRCm39) S148G probably benign Het
Minar1 T A 9: 89,484,398 (GRCm39) D333V probably damaging Het
Ndrg1 A G 15: 66,805,711 (GRCm39) probably null Het
Nlrp4a A T 7: 26,149,523 (GRCm39) N377Y probably damaging Het
Nox4 C T 7: 86,970,774 (GRCm39) T217I probably benign Het
Or7g21 T C 9: 19,033,193 (GRCm39) F311S possibly damaging Het
Or8b52 A T 9: 38,576,803 (GRCm39) Y112* probably null Het
Phf8-ps T C 17: 33,286,494 (GRCm39) I103V probably benign Het
Plekhd1 T A 12: 80,768,726 (GRCm39) F403Y possibly damaging Het
Plekhg1 T C 10: 3,913,805 (GRCm39) S1231P Het
Plekhg3 T A 12: 76,618,839 (GRCm39) M497K probably benign Het
Rpap1 T C 2: 119,604,669 (GRCm39) H413R probably damaging Het
Rragd A G 4: 32,995,924 (GRCm39) T90A probably damaging Het
Septin9 T C 11: 117,242,396 (GRCm39) M286T probably benign Het
Shpk GACCTTAGCCAGAAGGAGCCTTAGTTCATCAA GA 11: 73,113,996 (GRCm39) probably null Het
Slc22a2 T A 17: 12,838,757 (GRCm39) D528E probably benign Het
Slirp G A 12: 87,494,376 (GRCm39) R47K probably benign Het
Sncg T C 14: 34,096,474 (GRCm39) T22A possibly damaging Het
Tnfrsf21 A G 17: 43,398,801 (GRCm39) S636G probably damaging Het
Unc80 T G 1: 66,546,534 (GRCm39) S535R probably damaging Het
Vmn1r149 A T 7: 22,137,378 (GRCm39) S93T probably benign Het
Vps13d A G 4: 144,783,058 (GRCm39) Y3957H Het
Wdr35 T A 12: 9,036,000 (GRCm39) V257E possibly damaging Het
Wscd1 A G 11: 71,662,750 (GRCm39) T264A probably benign Het
Zfp266 G A 9: 20,413,337 (GRCm39) Q108* probably null Het
Zfp62 T A 11: 49,106,075 (GRCm39) S55R probably benign Het
Other mutations in Grid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Grid2 APN 6 64,322,573 (GRCm39) missense probably damaging 1.00
IGL00596:Grid2 APN 6 64,510,688 (GRCm39) missense possibly damaging 0.93
IGL01686:Grid2 APN 6 64,297,180 (GRCm39) missense probably benign 0.00
IGL01712:Grid2 APN 6 64,642,899 (GRCm39) missense possibly damaging 0.73
IGL02064:Grid2 APN 6 64,040,919 (GRCm39) missense probably benign 0.29
IGL02216:Grid2 APN 6 64,322,650 (GRCm39) missense probably damaging 0.96
IGL02563:Grid2 APN 6 64,322,857 (GRCm39) missense possibly damaging 0.94
IGL02685:Grid2 APN 6 64,322,800 (GRCm39) missense possibly damaging 0.50
IGL03129:Grid2 APN 6 64,040,888 (GRCm39) missense probably damaging 0.98
IGL03324:Grid2 APN 6 64,406,806 (GRCm39) missense possibly damaging 0.88
IGL03395:Grid2 APN 6 63,886,053 (GRCm39) missense possibly damaging 0.94
crawler UTSW 6 64,406,678 (GRCm39) nonsense probably null
swagger UTSW 6 64,372,263 (GRCm39) synonymous probably benign
R0133:Grid2 UTSW 6 64,297,116 (GRCm39) missense probably damaging 1.00
R0147:Grid2 UTSW 6 64,510,571 (GRCm39) missense probably benign
R0193:Grid2 UTSW 6 64,040,937 (GRCm39) missense possibly damaging 0.64
R0370:Grid2 UTSW 6 64,322,718 (GRCm39) missense possibly damaging 0.75
R0399:Grid2 UTSW 6 64,643,036 (GRCm39) missense probably benign 0.33
R0600:Grid2 UTSW 6 63,480,419 (GRCm39) missense probably benign 0.38
R0717:Grid2 UTSW 6 64,643,259 (GRCm39) missense possibly damaging 0.96
R1524:Grid2 UTSW 6 64,406,738 (GRCm39) missense possibly damaging 0.92
R1555:Grid2 UTSW 6 64,406,668 (GRCm39) missense possibly damaging 0.87
R1572:Grid2 UTSW 6 64,406,678 (GRCm39) nonsense probably null
R1762:Grid2 UTSW 6 64,510,638 (GRCm39) missense probably damaging 0.98
R1944:Grid2 UTSW 6 63,886,045 (GRCm39) missense probably damaging 1.00
R1961:Grid2 UTSW 6 63,885,877 (GRCm39) missense probably damaging 1.00
R1969:Grid2 UTSW 6 63,885,902 (GRCm39) nonsense probably null
R2138:Grid2 UTSW 6 64,322,782 (GRCm39) missense probably damaging 0.99
R3500:Grid2 UTSW 6 63,480,383 (GRCm39) missense probably damaging 0.97
R3547:Grid2 UTSW 6 64,297,005 (GRCm39) missense probably damaging 0.97
R3845:Grid2 UTSW 6 64,322,826 (GRCm39) missense possibly damaging 0.62
R4124:Grid2 UTSW 6 63,480,417 (GRCm39) missense probably benign 0.41
R4273:Grid2 UTSW 6 63,886,029 (GRCm39) missense probably damaging 1.00
R4591:Grid2 UTSW 6 64,297,086 (GRCm39) missense probably damaging 1.00
R4701:Grid2 UTSW 6 64,642,899 (GRCm39) missense probably benign 0.27
R4721:Grid2 UTSW 6 64,643,185 (GRCm39) missense probably benign 0.33
R4755:Grid2 UTSW 6 63,885,972 (GRCm39) missense probably benign 0.04
R4869:Grid2 UTSW 6 64,406,724 (GRCm39) missense probably damaging 1.00
R5083:Grid2 UTSW 6 64,297,136 (GRCm39) nonsense probably null
R5091:Grid2 UTSW 6 64,053,862 (GRCm39) missense probably benign 0.07
R5117:Grid2 UTSW 6 63,233,917 (GRCm39) missense probably benign 0.15
R5128:Grid2 UTSW 6 64,642,982 (GRCm39) missense probably benign 0.01
R5386:Grid2 UTSW 6 63,908,089 (GRCm39) missense probably damaging 0.99
R5404:Grid2 UTSW 6 63,907,894 (GRCm39) missense probably damaging 0.99
R5534:Grid2 UTSW 6 63,480,345 (GRCm39) missense probably benign
R5626:Grid2 UTSW 6 64,053,929 (GRCm39) critical splice donor site probably null
R5699:Grid2 UTSW 6 63,885,975 (GRCm39) missense probably damaging 0.99
R5700:Grid2 UTSW 6 64,071,416 (GRCm39) missense possibly damaging 0.95
R5876:Grid2 UTSW 6 64,640,146 (GRCm39) missense probably damaging 1.00
R6446:Grid2 UTSW 6 64,322,577 (GRCm39) missense probably damaging 1.00
R6694:Grid2 UTSW 6 63,908,031 (GRCm39) missense possibly damaging 0.92
R6697:Grid2 UTSW 6 63,908,031 (GRCm39) missense possibly damaging 0.92
R6699:Grid2 UTSW 6 63,908,031 (GRCm39) missense possibly damaging 0.92
R6767:Grid2 UTSW 6 63,907,999 (GRCm39) missense probably benign 0.01
R6895:Grid2 UTSW 6 64,372,283 (GRCm39) missense probably damaging 0.99
R6999:Grid2 UTSW 6 64,053,893 (GRCm39) missense possibly damaging 0.80
R7053:Grid2 UTSW 6 64,677,402 (GRCm39) missense unknown
R7126:Grid2 UTSW 6 64,053,794 (GRCm39) missense probably damaging 0.99
R7432:Grid2 UTSW 6 64,252,854 (GRCm39) missense possibly damaging 0.46
R7553:Grid2 UTSW 6 64,053,925 (GRCm39) missense possibly damaging 0.95
R7619:Grid2 UTSW 6 63,908,085 (GRCm39) missense possibly damaging 0.71
R7997:Grid2 UTSW 6 64,297,120 (GRCm39) missense possibly damaging 0.89
R8112:Grid2 UTSW 6 63,885,891 (GRCm39) missense probably damaging 0.99
R8296:Grid2 UTSW 6 63,233,929 (GRCm39) critical splice donor site probably null
R8320:Grid2 UTSW 6 63,233,917 (GRCm39) missense probably benign 0.15
R8467:Grid2 UTSW 6 64,510,635 (GRCm39) missense probably benign 0.01
R8691:Grid2 UTSW 6 63,480,321 (GRCm39) missense probably damaging 0.97
R8890:Grid2 UTSW 6 63,233,923 (GRCm39) missense probably benign
R8965:Grid2 UTSW 6 64,296,990 (GRCm39) missense probably damaging 1.00
R8968:Grid2 UTSW 6 64,643,139 (GRCm39) missense probably benign 0.14
R9371:Grid2 UTSW 6 64,677,506 (GRCm39) missense unknown
R9653:Grid2 UTSW 6 63,907,968 (GRCm39) missense possibly damaging 0.75
Z1176:Grid2 UTSW 6 64,640,212 (GRCm39) missense probably benign 0.03
Z1176:Grid2 UTSW 6 63,885,863 (GRCm39) missense possibly damaging 0.76
Z1177:Grid2 UTSW 6 64,322,841 (GRCm39) missense probably damaging 1.00
Z1177:Grid2 UTSW 6 64,322,840 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGCCAAAAGAAGCTTGCAC -3'
(R):5'- CATTCAAGTAGACAGGTGGACG -3'

Sequencing Primer
(F):5'- GCTTGCACAACACCACGGAG -3'
(R):5'- TTCAAGTAGACAGGTGGACGAACTG -3'
Posted On 2022-02-07