Mutagenetix > Incidental Mutation

Incidental Mutation 'R4273:Grid2'

322271

Institutional Source

Beutler Lab

Gene Symbol

Grid2

Ensembl Gene

ENSMUSG00000071424

Gene Name

glutamate receptor, ionotropic, delta 2

Synonyms

GluRdelta2, tpr, B230104L07Rik

MMRRC Submission

041645-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4273 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

63255876-64704323 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 63909045 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 142 (Y142H)

Ref Sequence

ENSEMBL: ENSMUSP00000093536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095852]

AlphaFold

Q61625

Predicted Effect

probably damaging
Transcript: ENSMUST00000095852
AA Change: Y142H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000093536
Gene: ENSMUSG00000071424
AA Change: Y142H

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	39	404	4.1e-41	PFAM
PBPe	442	807	5.98e-108	SMART
Lig_chan-Glu_bd	452	514	3.76e-24	SMART
transmembrane domain	830	852	N/A	INTRINSIC
low complexity region	945	956	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159561

SMART Domains

Protein: ENSMUSP00000125402
Gene: ENSMUSG00000071424

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	39	404	2.7e-36	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161105

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.7%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the family of ionotropic glutamate receptors which are the predominant excitatory neurotransmitter receptors in the mammalian brain. The encoded protein is a multi-pass membrane protein that is expressed selectively in cerebellar Purkinje cells. A point mutation in the mouse ortholog, associated with the phenotype named 'lurcher', in the heterozygous state leads to ataxia resulting from selective, cell-autonomous apoptosis of cerebellar Purkinje cells during postnatal development. Mice homozygous for this mutation die shortly after birth from massive loss of mid- and hindbrain neurons during late embryogenesis. This protein also plays a role in synapse organization between parallel fibers and Purkinje cells. Alternate splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause cerebellar ataxia in humans. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for multiple spontaneous and targeted null mutations exhibit ataxia and impaired locomotion associated with cerebellar Purkinje cell abnormalities and loss, and on some backgrounds, male infertility due to lack of zona penetration by sperm. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acer2	T	A	4: 86,874,598		probably null	Het
Adgrf2	T	A	17: 42,710,122	T604S	probably damaging	Het
Akap8l	T	A	17: 32,321,931	K533*	probably null	Het
Appbp2	T	C	11: 85,234,676	Y45C	probably damaging	Het
Arap2	T	C	5: 62,670,979	I950V	possibly damaging	Het
Arhgap31	T	C	16: 38,602,335	E1123G	possibly damaging	Het
Atp2c1	G	T	9: 105,435,140	N493K	probably benign	Het
Bcr	T	C	10: 75,125,111	I458T	probably damaging	Het
Brd4	G	A	17: 32,214,782	T468I	probably benign	Het
Cdh23	T	A	10: 60,311,161	D2774V	possibly damaging	Het
Cfdp1	T	C	8: 111,768,785	Y267C	probably damaging	Het
Chd6	C	A	2: 160,961,291	A2156S	probably benign	Het
Dazap2	C	A	15: 100,618,090	P100T	probably damaging	Het
Disp1	T	A	1: 183,087,644	I1071F	possibly damaging	Het
Dlgap1	T	A	17: 70,766,043	S686T	probably benign	Het
Dst	C	T	1: 34,192,340	R3183C	possibly damaging	Het
Enpp4	T	C	17: 44,101,807	N279D	probably benign	Het
Exoc3l	T	C	8: 105,289,961	*740W	probably null	Het
Exoc5	A	T	14: 49,015,480	C625*	probably null	Het
Fam98b	A	T	2: 117,260,231	N137Y	possibly damaging	Het
Fat4	T	A	3: 38,891,627	D1556E	probably damaging	Het
Fcer2a	C	A	8: 3,682,848	V319L	possibly damaging	Het
Fer1l6	T	C	15: 58,627,522	V1247A	probably benign	Het
Fmo4	A	G	1: 162,805,179	V201A	probably damaging	Het
Fras1	G	A	5: 96,614,904	G755D	probably benign	Het
Gm13078	A	T	4: 143,726,846	K175*	probably null	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Ibtk	T	C	9: 85,726,731	Q376R	probably damaging	Het
Impdh2	T	C	9: 108,564,956	M414T	probably damaging	Het
Itm2c	A	G	1: 85,907,029	T160A	probably damaging	Het
Kcna2	T	A	3: 107,105,193	D363E	probably benign	Het
Lama2	C	T	10: 27,347,054	C412Y	probably damaging	Het
Lims2	C	G	18: 31,956,337	T151S	probably benign	Het
Mier1	T	C	4: 103,162,431	S423P	possibly damaging	Het
Mrgpra3	A	T	7: 47,589,432	W249R	probably benign	Het
Mtor	A	G	4: 148,550,152	H2410R	probably benign	Het
Mvp	C	T	7: 126,989,703	A631T	probably benign	Het
Nepro	T	C	16: 44,735,829	V450A	possibly damaging	Het
Ngrn	T	C	7: 80,264,521	V140A	probably damaging	Het
Nobox	T	C	6: 43,306,008	E231G	probably benign	Het
Olfr129	A	T	17: 38,055,272	I98N	probably damaging	Het
P3h2	T	A	16: 26,105,221	I155F	probably benign	Het
Pcdha3	C	T	18: 36,948,091	R629C	probably damaging	Het
Riok3	AGAAGCGG	AG	18: 12,135,941		probably benign	Het
Rttn	T	C	18: 89,091,896	I1675T	probably benign	Het
Sall2	C	A	14: 52,313,803	R643L	probably damaging	Het
Slc35f4	G	T	14: 49,304,301	T182N	possibly damaging	Het
Slc52a3	T	A	2: 152,005,740	I256N	possibly damaging	Het
Sox9	T	C	11: 112,785,154	S390P	possibly damaging	Het
Tango2	T	C	16: 18,302,790		probably benign	Het
Tas1r1	T	C	4: 152,032,157	E340G	possibly damaging	Het
Tek	G	A	4: 94,829,970	G524R	probably damaging	Het
Tmem260	A	T	14: 48,505,304	Y532F	probably benign	Het
Tsks	C	A	7: 44,957,929	L559I	probably damaging	Het
Unc79	C	A	12: 103,122,353	L1702I	probably damaging	Het
Vmn1r14	T	A	6: 57,234,148	I237N	probably damaging	Het
Vmn2r17	G	A	5: 109,452,966	C710Y	probably benign	Het
Zfp119b	G	T	17: 55,938,926	T420K	possibly damaging	Het
Zfp202	C	T	9: 40,207,494	R68*	probably null	Het
Zfp229	T	A	17: 21,746,821	S677R	probably benign	Het
Zfp462	C	T	4: 55,008,411	H126Y	probably benign	Het
Zfp52	C	A	17: 21,560,197	Y102*	probably null	Het
Zfp616	T	A	11: 74,083,700	M265K	probably benign	Het
Zfyve9	A	T	4: 108,680,976	I1031N	probably damaging	Het
Zmynd11	T	C	13: 9,697,690	Y203C	probably damaging	Het

Other mutations in Grid2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00580:Grid2	APN	6	64345589	missense	probably damaging	1.00
IGL00596:Grid2	APN	6	64533704	missense	possibly damaging	0.93
IGL01686:Grid2	APN	6	64320196	missense	probably benign	0.00
IGL01712:Grid2	APN	6	64665915	missense	possibly damaging	0.73
IGL02064:Grid2	APN	6	64063935	missense	probably benign	0.29
IGL02216:Grid2	APN	6	64345666	missense	probably damaging	0.96
IGL02563:Grid2	APN	6	64345873	missense	possibly damaging	0.94
IGL02685:Grid2	APN	6	64345816	missense	possibly damaging	0.50
IGL03129:Grid2	APN	6	64063904	missense	probably damaging	0.98
IGL03324:Grid2	APN	6	64429822	missense	possibly damaging	0.88
IGL03395:Grid2	APN	6	63909069	missense	possibly damaging	0.94
crawler	UTSW	6	64429694	nonsense	probably null
swagger	UTSW	6	64395279	synonymous	probably benign
R0133:Grid2	UTSW	6	64320132	missense	probably damaging	1.00
R0147:Grid2	UTSW	6	64533587	missense	probably benign
R0193:Grid2	UTSW	6	64063953	missense	possibly damaging	0.64
R0370:Grid2	UTSW	6	64345734	missense	possibly damaging	0.75
R0399:Grid2	UTSW	6	64666052	missense	probably benign	0.33
R0600:Grid2	UTSW	6	63503435	missense	probably benign	0.38
R0717:Grid2	UTSW	6	64666275	missense	possibly damaging	0.96
R1524:Grid2	UTSW	6	64429754	missense	possibly damaging	0.92
R1555:Grid2	UTSW	6	64429684	missense	possibly damaging	0.87
R1572:Grid2	UTSW	6	64429694	nonsense	probably null
R1762:Grid2	UTSW	6	64533654	missense	probably damaging	0.98
R1944:Grid2	UTSW	6	63909061	missense	probably damaging	1.00
R1961:Grid2	UTSW	6	63908893	missense	probably damaging	1.00
R1969:Grid2	UTSW	6	63908918	nonsense	probably null
R2138:Grid2	UTSW	6	64345798	missense	probably damaging	0.99
R3500:Grid2	UTSW	6	63503399	missense	probably damaging	0.97
R3547:Grid2	UTSW	6	64320021	missense	probably damaging	0.97
R3845:Grid2	UTSW	6	64345842	missense	possibly damaging	0.62
R4124:Grid2	UTSW	6	63503433	missense	probably benign	0.41
R4591:Grid2	UTSW	6	64320102	missense	probably damaging	1.00
R4701:Grid2	UTSW	6	64665915	missense	probably benign	0.27
R4721:Grid2	UTSW	6	64666201	missense	probably benign	0.33
R4755:Grid2	UTSW	6	63908988	missense	probably benign	0.04
R4869:Grid2	UTSW	6	64429740	missense	probably damaging	1.00
R5083:Grid2	UTSW	6	64320152	nonsense	probably null
R5091:Grid2	UTSW	6	64076878	missense	probably benign	0.07
R5117:Grid2	UTSW	6	63256933	missense	probably benign	0.15
R5128:Grid2	UTSW	6	64665998	missense	probably benign	0.01
R5386:Grid2	UTSW	6	63931105	missense	probably damaging	0.99
R5404:Grid2	UTSW	6	63930910	missense	probably damaging	0.99
R5534:Grid2	UTSW	6	63503361	missense	probably benign
R5626:Grid2	UTSW	6	64076945	critical splice donor site	probably null
R5699:Grid2	UTSW	6	63908991	missense	probably damaging	0.99
R5700:Grid2	UTSW	6	64094432	missense	possibly damaging	0.95
R5876:Grid2	UTSW	6	64663162	missense	probably damaging	1.00
R6446:Grid2	UTSW	6	64345593	missense	probably damaging	1.00
R6694:Grid2	UTSW	6	63931047	missense	possibly damaging	0.92
R6697:Grid2	UTSW	6	63931047	missense	possibly damaging	0.92
R6699:Grid2	UTSW	6	63931047	missense	possibly damaging	0.92
R6767:Grid2	UTSW	6	63931015	missense	probably benign	0.01
R6895:Grid2	UTSW	6	64395299	missense	probably damaging	0.99
R6999:Grid2	UTSW	6	64076909	missense	possibly damaging	0.80
R7053:Grid2	UTSW	6	64700418	missense	unknown
R7126:Grid2	UTSW	6	64076810	missense	probably damaging	0.99
R7432:Grid2	UTSW	6	64275870	missense	possibly damaging	0.46
R7553:Grid2	UTSW	6	64076941	missense	possibly damaging	0.95
R7619:Grid2	UTSW	6	63931101	missense	possibly damaging	0.71
R7997:Grid2	UTSW	6	64320136	missense	possibly damaging	0.89
R8112:Grid2	UTSW	6	63908907	missense	probably damaging	0.99
R8296:Grid2	UTSW	6	63256945	critical splice donor site	probably null
R8320:Grid2	UTSW	6	63256933	missense	probably benign	0.15
R8467:Grid2	UTSW	6	64533651	missense	probably benign	0.01
R8691:Grid2	UTSW	6	63503337	missense	probably damaging	0.97
R8890:Grid2	UTSW	6	63256939	missense	probably benign
R8965:Grid2	UTSW	6	64320006	missense	probably damaging	1.00
R8968:Grid2	UTSW	6	64666155	missense	probably benign	0.14
R9220:Grid2	UTSW	6	63908904	missense	probably damaging	1.00
R9371:Grid2	UTSW	6	64700522	missense	unknown
R9653:Grid2	UTSW	6	63930984	missense	possibly damaging	0.75
Z1176:Grid2	UTSW	6	63908879	missense	possibly damaging	0.76
Z1176:Grid2	UTSW	6	64663228	missense	probably benign	0.03
Z1177:Grid2	UTSW	6	64345856	nonsense	probably null
Z1177:Grid2	UTSW	6	64345857	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGAACCAGGGCATCTTGGC -3'
(R):5'- TGTCTTACACACTCCAACAGG -3'

Sequencing Primer
(F):5'- GCCTTGGTCAGCTCCATTGG -3'
(R):5'- CACTCCAACAGGTATTTATGTTTACG -3'

Posted On

2015-06-20