Incidental Mutation 'R0744:Ppp1r16a'
ID 70884
Institutional Source Beutler Lab
Gene Symbol Ppp1r16a
Ensembl Gene ENSMUSG00000033819
Gene Name protein phosphatase 1, regulatory (inhibitor) subunit 16A
Synonyms R75527, Mypt3, 2900084E10Rik
MMRRC Submission 038925-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock # R0744 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 76671615-76694919 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 76693669 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 328 (Q328*)
Ref Sequence ENSEMBL: ENSMUSP00000155515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023203] [ENSMUST00000037551] [ENSMUST00000135388] [ENSMUST00000150399] [ENSMUST00000229140] [ENSMUST00000229679] [ENSMUST00000229734] [ENSMUST00000231028]
AlphaFold Q923M0
Predicted Effect probably benign
Transcript: ENSMUST00000023203
SMART Domains Protein: ENSMUSP00000023203
Gene: ENSMUSG00000022546

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 83 484 7.8e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000037551
AA Change: Q328*
SMART Domains Protein: ENSMUSP00000037356
Gene: ENSMUSG00000033819
AA Change: Q328*

DomainStartEndE-ValueType
ANK 70 99 2.5e3 SMART
ANK 103 132 3.41e-3 SMART
ANK 136 165 2.66e-5 SMART
ANK 231 260 2.58e-3 SMART
ANK 264 293 4.03e-5 SMART
low complexity region 323 346 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129396
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134449
Predicted Effect probably null
Transcript: ENSMUST00000135388
AA Change: Q328*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143274
Predicted Effect probably benign
Transcript: ENSMUST00000150399
SMART Domains Protein: ENSMUSP00000123458
Gene: ENSMUSG00000033819

DomainStartEndE-ValueType
ANK 70 99 2.5e3 SMART
ANK 103 132 3.41e-3 SMART
ANK 136 165 2.66e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156920
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228987
Predicted Effect probably benign
Transcript: ENSMUST00000229140
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229340
Predicted Effect probably benign
Transcript: ENSMUST00000229679
Predicted Effect probably benign
Transcript: ENSMUST00000229734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230283
Predicted Effect probably benign
Transcript: ENSMUST00000231028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230482
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 98% (91/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin light chain kinase and phosphatase (MLCP) complexes control the phosphorylation states of regulatory myosin light chains, which is crucial for muscle and intracellular movement. MLCPs typically contain a catalytic protein phosphatase 1 (PP1c) subunit, a myosin phosphatase targeting (MYPT) subunit, and another smaller subunit. The protein encoded by this gene represents an MYPT subunit, which is responsible for directing PP1c to its intended targets. However, while other MYPTs result in PP1c activation after becoming phosphorylated, the encoded protein is phosphorylated by protein kinase A and then inhibits the catalytic activity of PP1c. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,165,069 L41P probably damaging Het
A930003A15Rik T C 16: 19,883,872 noncoding transcript Het
Abca8a A T 11: 110,040,564 D1253E possibly damaging Het
Acsm3 T C 7: 119,777,100 I350T possibly damaging Het
Adcy9 T C 16: 4,419,271 D92G possibly damaging Het
Aebp2 T G 6: 140,642,364 probably null Het
AI987944 T C 7: 41,376,859 Y6C probably damaging Het
Ascc3 T C 10: 50,845,666 W2072R probably benign Het
Asxl3 A G 18: 22,516,040 D362G probably damaging Het
Baiap2l1 T A 5: 144,266,641 D479V probably benign Het
Bdp1 A T 13: 100,035,825 H2094Q probably benign Het
Bptf C A 11: 107,110,812 probably null Het
Camk4 G T 18: 32,939,454 S20I unknown Het
Ccdc36 A T 9: 108,404,801 C563S probably benign Het
Ccdc85a T A 11: 28,583,296 I83F probably damaging Het
Ccnt2 T A 1: 127,802,394 M336K probably benign Het
Cd209e G T 8: 3,853,205 D62E probably benign Het
Cd226 A C 18: 89,207,020 probably benign Het
Clip1 T C 5: 123,630,721 D605G probably benign Het
Crtc1 A G 8: 70,393,013 V306A probably benign Het
D130043K22Rik G A 13: 24,863,580 probably benign Het
Dmxl1 T C 18: 49,833,148 V20A probably damaging Het
Dzip3 A G 16: 48,959,675 Y301H probably damaging Het
Ephb4 T A 5: 137,365,667 N600K probably damaging Het
Erich6 T A 3: 58,636,122 probably benign Het
Fbn1 T C 2: 125,314,814 probably benign Het
Fryl A T 5: 73,089,081 probably benign Het
Galnt17 T A 5: 131,150,916 D131V probably damaging Het
Gm13089 A T 4: 143,698,486 M129K probably benign Het
Gm597 A G 1: 28,777,821 S377P possibly damaging Het
Gm6619 T A 6: 131,490,334 L54Q probably damaging Het
Herc2 T C 7: 56,206,036 probably benign Het
Hic1 T A 11: 75,165,801 Q754L possibly damaging Het
Hnf4g A T 3: 3,651,629 D286V possibly damaging Het
Itgb5 A G 16: 33,900,583 K339R probably damaging Het
Itih1 A T 14: 30,941,555 V164E probably damaging Het
Jak3 A C 8: 71,683,978 N643T probably damaging Het
Lamp1 T A 8: 13,172,654 F279L probably damaging Het
Lrfn5 A C 12: 61,839,668 T81P probably damaging Het
Lrrc58 A G 16: 37,878,573 probably benign Het
March6 T C 15: 31,480,291 Y562C probably benign Het
Mark1 T A 1: 184,921,608 I166F probably damaging Het
Mark2 A G 19: 7,285,824 Y193H probably damaging Het
Mast4 C G 13: 102,737,387 Q1632H probably damaging Het
Mcrs1 T C 15: 99,243,449 probably benign Het
Mgst3 A G 1: 167,373,805 Y104H probably damaging Het
Mlxipl C T 5: 135,132,475 T416I possibly damaging Het
Mthfd2l T C 5: 90,946,942 V90A probably damaging Het
Mtnr1a A T 8: 45,087,937 I312F probably benign Het
Muc1 C A 3: 89,230,328 P159Q possibly damaging Het
Myom2 A T 8: 15,132,924 K1454* probably null Het
Myt1 TGAGGAGGAGGAGGAGGAGG TGAGGAGGAGGAGGAGG 2: 181,797,505 probably benign Het
Olfr1513 T C 14: 52,349,378 I223V probably benign Het
Olfr329-ps T A 11: 58,543,162 M105L possibly damaging Het
Olfr504 T C 7: 108,564,998 T266A possibly damaging Het
Olfr629 T C 7: 103,740,925 H105R probably damaging Het
Olfr905 A T 9: 38,472,785 I13F probably benign Het
Pdcd6 A G 13: 74,316,324 probably benign Het
Pzp A G 6: 128,516,195 probably benign Het
Rab27b T C 18: 69,987,041 probably benign Het
Rapgef3 G A 15: 97,761,585 probably benign Het
Rapsn T C 2: 91,036,808 Y152H probably damaging Het
Rgs11 T A 17: 26,203,318 M29K probably damaging Het
Rictor A G 15: 6,764,278 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rims1 T C 1: 22,427,459 probably null Het
Samd9l T C 6: 3,372,725 E1512G possibly damaging Het
Sgsm1 C T 5: 113,279,184 A127T probably benign Het
Slc22a28 T C 19: 8,116,833 Y245C possibly damaging Het
Slc25a1 T A 16: 17,927,436 H78L probably benign Het
Slc26a1 T A 5: 108,673,523 T167S probably benign Het
Slc2a12 T C 10: 22,702,016 probably benign Het
Slc44a5 T C 3: 154,265,474 S654P probably damaging Het
Slc51a T A 16: 32,475,849 T306S probably benign Het
Slc6a13 T G 6: 121,302,867 W67G probably damaging Het
Sowahc GGGAGGAGGAGGAGGAGGAGGAGGAGGA GGGAGGAGGAGGAGGAGGAGGAGGA 10: 59,223,491 probably benign Het
Sp100 A T 1: 85,699,744 I86L probably damaging Het
Supt20 T A 3: 54,714,701 Y409N probably damaging Het
Synrg C T 11: 84,024,305 Q1046* probably null Het
Tab2 T C 10: 7,907,581 probably benign Het
Tcof1 T C 18: 60,845,832 D48G probably damaging Het
Tex24 A T 8: 27,344,720 H92L possibly damaging Het
Tgm6 T C 2: 130,151,761 V640A probably benign Het
Tle2 T C 10: 81,588,947 F667L probably damaging Het
Tnfaip3 C A 10: 19,002,949 A704S probably benign Het
Tomm34 T C 2: 164,070,976 N22D probably benign Het
Trabd2b A G 4: 114,580,322 Q232R probably benign Het
Trim62 A G 4: 128,884,215 S16G probably damaging Het
Ttc28 T A 5: 111,231,081 I1144N probably damaging Het
Unc5a C A 13: 55,003,933 N56K possibly damaging Het
Ush2a C T 1: 188,814,406 probably benign Het
Wrn A G 8: 33,295,006 I446T possibly damaging Het
Zbed5 T A 5: 129,902,272 V354E possibly damaging Het
Zfp266 G A 9: 20,499,799 H361Y probably damaging Het
Other mutations in Ppp1r16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Ppp1r16a APN 15 76694544 missense probably benign
IGL01449:Ppp1r16a APN 15 76694294 unclassified probably benign
IGL02128:Ppp1r16a APN 15 76693978 missense probably benign
IGL02331:Ppp1r16a APN 15 76691000 missense probably benign
R0057:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0060:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0113:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0114:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0244:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0352:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0646:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0652:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0722:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0833:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0834:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0835:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0836:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0885:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0942:Ppp1r16a UTSW 15 76694011 missense probably damaging 0.98
R1061:Ppp1r16a UTSW 15 76693669 nonsense probably null
R1168:Ppp1r16a UTSW 15 76693669 nonsense probably null
R1170:Ppp1r16a UTSW 15 76693669 nonsense probably null
R1171:Ppp1r16a UTSW 15 76693669 nonsense probably null
R1503:Ppp1r16a UTSW 15 76694399 missense probably benign
R1572:Ppp1r16a UTSW 15 76693669 nonsense probably null
R1914:Ppp1r16a UTSW 15 76693068 missense probably damaging 1.00
R1915:Ppp1r16a UTSW 15 76693068 missense probably damaging 1.00
R2085:Ppp1r16a UTSW 15 76693596 missense probably damaging 0.99
R4823:Ppp1r16a UTSW 15 76693193 unclassified probably benign
R5153:Ppp1r16a UTSW 15 76694396 nonsense probably null
R5443:Ppp1r16a UTSW 15 76694646 missense possibly damaging 0.95
R5481:Ppp1r16a UTSW 15 76691021 missense probably damaging 1.00
R6900:Ppp1r16a UTSW 15 76691723 missense probably damaging 1.00
R7165:Ppp1r16a UTSW 15 76690904 missense probably damaging 1.00
R7686:Ppp1r16a UTSW 15 76694583 missense probably benign 0.37
R8138:Ppp1r16a UTSW 15 76691721 missense probably damaging 1.00
R9150:Ppp1r16a UTSW 15 76690854 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AAATCTCTGGTGGACGAGACACCC -3'
(R):5'- ATGCTCCTTGCGGTACAGGTTG -3'

Sequencing Primer
(F):5'- ACCCCTCGGTGAGTGTG -3'
(R):5'- ATGTGTCAGGCTCACTCG -3'
Posted On 2013-09-30