Incidental Mutation 'R0744:Slc6a13'
ID 70844
Institutional Source Beutler Lab
Gene Symbol Slc6a13
Ensembl Gene ENSMUSG00000030108
Gene Name solute carrier family 6 (neurotransmitter transporter, GABA), member 13
Synonyms Gat2, Gabt3
MMRRC Submission 038925-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.762) question?
Stock # R0744 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 121300227-121337733 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 121302867 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Glycine at position 67 (W67G)
Ref Sequence ENSEMBL: ENSMUSP00000120689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064580] [ENSMUST00000142419]
AlphaFold P31649
Predicted Effect probably damaging
Transcript: ENSMUST00000064580
AA Change: W56G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066779
Gene: ENSMUSG00000030108
AA Change: W56G

DomainStartEndE-ValueType
Pfam:SNF 32 556 6.2e-252 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142021
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142144
Predicted Effect probably damaging
Transcript: ENSMUST00000142419
AA Change: W67G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120689
Gene: ENSMUSG00000030108
AA Change: W67G

DomainStartEndE-ValueType
Pfam:SNF 43 192 4e-78 PFAM
Meta Mutation Damage Score 0.9404 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 98% (91/93)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced taurine levels in the liver and increased taurine levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,165,069 L41P probably damaging Het
A930003A15Rik T C 16: 19,883,872 noncoding transcript Het
Abca8a A T 11: 110,040,564 D1253E possibly damaging Het
Acsm3 T C 7: 119,777,100 I350T possibly damaging Het
Adcy9 T C 16: 4,419,271 D92G possibly damaging Het
Aebp2 T G 6: 140,642,364 probably null Het
AI987944 T C 7: 41,376,859 Y6C probably damaging Het
Ascc3 T C 10: 50,845,666 W2072R probably benign Het
Asxl3 A G 18: 22,516,040 D362G probably damaging Het
Baiap2l1 T A 5: 144,266,641 D479V probably benign Het
Bdp1 A T 13: 100,035,825 H2094Q probably benign Het
Bptf C A 11: 107,110,812 probably null Het
Camk4 G T 18: 32,939,454 S20I unknown Het
Ccdc36 A T 9: 108,404,801 C563S probably benign Het
Ccdc85a T A 11: 28,583,296 I83F probably damaging Het
Ccnt2 T A 1: 127,802,394 M336K probably benign Het
Cd209e G T 8: 3,853,205 D62E probably benign Het
Cd226 A C 18: 89,207,020 probably benign Het
Clip1 T C 5: 123,630,721 D605G probably benign Het
Crtc1 A G 8: 70,393,013 V306A probably benign Het
D130043K22Rik G A 13: 24,863,580 probably benign Het
Dmxl1 T C 18: 49,833,148 V20A probably damaging Het
Dzip3 A G 16: 48,959,675 Y301H probably damaging Het
Ephb4 T A 5: 137,365,667 N600K probably damaging Het
Erich6 T A 3: 58,636,122 probably benign Het
Fbn1 T C 2: 125,314,814 probably benign Het
Fryl A T 5: 73,089,081 probably benign Het
Galnt17 T A 5: 131,150,916 D131V probably damaging Het
Gm13089 A T 4: 143,698,486 M129K probably benign Het
Gm597 A G 1: 28,777,821 S377P possibly damaging Het
Gm6619 T A 6: 131,490,334 L54Q probably damaging Het
Herc2 T C 7: 56,206,036 probably benign Het
Hic1 T A 11: 75,165,801 Q754L possibly damaging Het
Hnf4g A T 3: 3,651,629 D286V possibly damaging Het
Itgb5 A G 16: 33,900,583 K339R probably damaging Het
Itih1 A T 14: 30,941,555 V164E probably damaging Het
Jak3 A C 8: 71,683,978 N643T probably damaging Het
Lamp1 T A 8: 13,172,654 F279L probably damaging Het
Lrfn5 A C 12: 61,839,668 T81P probably damaging Het
Lrrc58 A G 16: 37,878,573 probably benign Het
March6 T C 15: 31,480,291 Y562C probably benign Het
Mark1 T A 1: 184,921,608 I166F probably damaging Het
Mark2 A G 19: 7,285,824 Y193H probably damaging Het
Mast4 C G 13: 102,737,387 Q1632H probably damaging Het
Mcrs1 T C 15: 99,243,449 probably benign Het
Mgst3 A G 1: 167,373,805 Y104H probably damaging Het
Mlxipl C T 5: 135,132,475 T416I possibly damaging Het
Mthfd2l T C 5: 90,946,942 V90A probably damaging Het
Mtnr1a A T 8: 45,087,937 I312F probably benign Het
Muc1 C A 3: 89,230,328 P159Q possibly damaging Het
Myom2 A T 8: 15,132,924 K1454* probably null Het
Myt1 TGAGGAGGAGGAGGAGGAGG TGAGGAGGAGGAGGAGG 2: 181,797,505 probably benign Het
Olfr1513 T C 14: 52,349,378 I223V probably benign Het
Olfr329-ps T A 11: 58,543,162 M105L possibly damaging Het
Olfr504 T C 7: 108,564,998 T266A possibly damaging Het
Olfr629 T C 7: 103,740,925 H105R probably damaging Het
Olfr905 A T 9: 38,472,785 I13F probably benign Het
Pdcd6 A G 13: 74,316,324 probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Pzp A G 6: 128,516,195 probably benign Het
Rab27b T C 18: 69,987,041 probably benign Het
Rapgef3 G A 15: 97,761,585 probably benign Het
Rapsn T C 2: 91,036,808 Y152H probably damaging Het
Rgs11 T A 17: 26,203,318 M29K probably damaging Het
Rictor A G 15: 6,764,278 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rims1 T C 1: 22,427,459 probably null Het
Samd9l T C 6: 3,372,725 E1512G possibly damaging Het
Sgsm1 C T 5: 113,279,184 A127T probably benign Het
Slc22a28 T C 19: 8,116,833 Y245C possibly damaging Het
Slc25a1 T A 16: 17,927,436 H78L probably benign Het
Slc26a1 T A 5: 108,673,523 T167S probably benign Het
Slc2a12 T C 10: 22,702,016 probably benign Het
Slc44a5 T C 3: 154,265,474 S654P probably damaging Het
Slc51a T A 16: 32,475,849 T306S probably benign Het
Sowahc GGGAGGAGGAGGAGGAGGAGGAGGAGGA GGGAGGAGGAGGAGGAGGAGGAGGA 10: 59,223,491 probably benign Het
Sp100 A T 1: 85,699,744 I86L probably damaging Het
Supt20 T A 3: 54,714,701 Y409N probably damaging Het
Synrg C T 11: 84,024,305 Q1046* probably null Het
Tab2 T C 10: 7,907,581 probably benign Het
Tcof1 T C 18: 60,845,832 D48G probably damaging Het
Tex24 A T 8: 27,344,720 H92L possibly damaging Het
Tgm6 T C 2: 130,151,761 V640A probably benign Het
Tle2 T C 10: 81,588,947 F667L probably damaging Het
Tnfaip3 C A 10: 19,002,949 A704S probably benign Het
Tomm34 T C 2: 164,070,976 N22D probably benign Het
Trabd2b A G 4: 114,580,322 Q232R probably benign Het
Trim62 A G 4: 128,884,215 S16G probably damaging Het
Ttc28 T A 5: 111,231,081 I1144N probably damaging Het
Unc5a C A 13: 55,003,933 N56K possibly damaging Het
Ush2a C T 1: 188,814,406 probably benign Het
Wrn A G 8: 33,295,006 I446T possibly damaging Het
Zbed5 T A 5: 129,902,272 V354E possibly damaging Het
Zfp266 G A 9: 20,499,799 H361Y probably damaging Het
Other mutations in Slc6a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Slc6a13 APN 6 121321641 missense probably damaging 1.00
IGL01947:Slc6a13 APN 6 121325157 critical splice donor site probably null
IGL01969:Slc6a13 APN 6 121335642 missense probably damaging 1.00
IGL02546:Slc6a13 APN 6 121333364 missense probably benign
IGL02988:Slc6a13 APN 6 121326107 unclassified probably benign
IGL03093:Slc6a13 APN 6 121332448 missense probably damaging 1.00
IGL03358:Slc6a13 APN 6 121334536 missense probably benign
IGL03384:Slc6a13 APN 6 121332391 missense probably damaging 1.00
ANU74:Slc6a13 UTSW 6 121334876 missense probably benign 0.42
R0217:Slc6a13 UTSW 6 121324320 missense probably damaging 0.99
R0230:Slc6a13 UTSW 6 121324303 missense probably benign 0.03
R1546:Slc6a13 UTSW 6 121332374 missense possibly damaging 0.78
R1604:Slc6a13 UTSW 6 121332369 missense probably benign 0.02
R1654:Slc6a13 UTSW 6 121336926 missense probably benign
R1781:Slc6a13 UTSW 6 121334852 missense probably damaging 0.99
R1978:Slc6a13 UTSW 6 121332373 missense probably damaging 1.00
R2130:Slc6a13 UTSW 6 121325041 missense possibly damaging 0.77
R4570:Slc6a13 UTSW 6 121336142 critical splice donor site probably null
R4623:Slc6a13 UTSW 6 121325145 missense probably damaging 0.99
R4755:Slc6a13 UTSW 6 121325049 missense probably damaging 1.00
R5068:Slc6a13 UTSW 6 121333342 missense probably damaging 0.99
R5485:Slc6a13 UTSW 6 121336073 missense probably damaging 1.00
R5687:Slc6a13 UTSW 6 121302741 missense probably benign 0.00
R6045:Slc6a13 UTSW 6 121321628 missense probably damaging 1.00
R6235:Slc6a13 UTSW 6 121302794 missense probably benign 0.02
R6338:Slc6a13 UTSW 6 121334839 missense probably damaging 0.96
R6393:Slc6a13 UTSW 6 121336842 missense possibly damaging 0.83
R6844:Slc6a13 UTSW 6 121325053 missense probably damaging 0.99
R7379:Slc6a13 UTSW 6 121336839 nonsense probably null
R7734:Slc6a13 UTSW 6 121337375 missense probably benign 0.00
R7800:Slc6a13 UTSW 6 121321699 missense probably damaging 0.98
R7862:Slc6a13 UTSW 6 121335630 missense probably damaging 1.00
R7935:Slc6a13 UTSW 6 121334491 missense possibly damaging 0.46
R8177:Slc6a13 UTSW 6 121325028 nonsense probably null
R8324:Slc6a13 UTSW 6 121337414 makesense probably null
R8457:Slc6a13 UTSW 6 121326104 splice site probably null
R8992:Slc6a13 UTSW 6 121336942 nonsense probably null
R8995:Slc6a13 UTSW 6 121325053 missense probably damaging 1.00
R9104:Slc6a13 UTSW 6 121336085 missense probably benign
R9168:Slc6a13 UTSW 6 121325083 missense probably damaging 1.00
R9235:Slc6a13 UTSW 6 121325025 missense probably damaging 0.98
R9242:Slc6a13 UTSW 6 121318269 missense probably damaging 0.99
RF020:Slc6a13 UTSW 6 121324351 critical splice donor site probably null
Z1177:Slc6a13 UTSW 6 121334503 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- TGACAGAGCACTGCACTTGTTTTCC -3'
(R):5'- CCAGAAGAGTTTGGTAGCAGCAGC -3'

Sequencing Primer
(F):5'- TTTCCAGGTGGGATGGAGAAC -3'
(R):5'- acaggaacagccattgagac -3'
Posted On 2013-09-30