Incidental Mutation 'R9405:Efcab5'
ID 711479
Institutional Source Beutler Lab
Gene Symbol Efcab5
Ensembl Gene ENSMUSG00000050944
Gene Name EF-hand calcium binding domain 5
Synonyms 4930563A03Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock # R9405 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 77089915-77188968 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 77132108 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 593 (T593I)
Ref Sequence ENSEMBL: ENSMUSP00000118152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108400] [ENSMUST00000130901]
AlphaFold A0JP43
Predicted Effect probably damaging
Transcript: ENSMUST00000108400
AA Change: T729I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104037
Gene: ENSMUSG00000050944
AA Change: T729I

DomainStartEndE-ValueType
low complexity region 71 84 N/A INTRINSIC
low complexity region 210 219 N/A INTRINSIC
internal_repeat_1 250 352 2.42e-20 PROSPERO
internal_repeat_1 354 452 2.42e-20 PROSPERO
low complexity region 498 513 N/A INTRINSIC
coiled coil region 749 776 N/A INTRINSIC
GAF 877 1066 1.78e-2 SMART
low complexity region 1235 1245 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130901
AA Change: T593I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118152
Gene: ENSMUSG00000050944
AA Change: T593I

DomainStartEndE-ValueType
low complexity region 74 83 N/A INTRINSIC
internal_repeat_1 114 216 1.89e-19 PROSPERO
internal_repeat_1 218 316 1.89e-19 PROSPERO
low complexity region 362 377 N/A INTRINSIC
coiled coil region 613 640 N/A INTRINSIC
GAF 741 930 1.78e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T A 9: 119,149,438 Q277L probably damaging Het
Adamts18 A G 8: 113,703,398 V1135A probably damaging Het
Apobr A G 7: 126,585,532 S72G possibly damaging Het
Arl13b T A 16: 62,811,897 Q214L possibly damaging Het
Armt1 AC A 10: 4,450,848 probably null Het
Asah2 T G 19: 32,008,645 T542P possibly damaging Het
Asns C T 6: 7,689,283 C73Y probably damaging Het
C130060K24Rik T A 6: 65,456,094 N299K probably benign Het
Calhm2 T A 19: 47,135,669 T79S probably benign Het
Cd300c2 T G 11: 115,000,761 T96P probably damaging Het
Copb1 G A 7: 114,223,223 T757I possibly damaging Het
Csmd3 T A 15: 47,675,791 T1517S Het
Ddx60 T A 8: 61,972,214 L679M probably benign Het
Dip2b A G 15: 100,195,876 K1123R probably benign Het
Dnah17 A G 11: 118,118,911 S612P probably benign Het
Dnah5 T A 15: 28,272,160 C1037S probably benign Het
Ei24 A T 9: 36,782,841 I244N possibly damaging Het
Epb41l4a C A 18: 33,810,218 probably null Het
Fam83b A G 9: 76,491,421 M800T possibly damaging Het
Fcf1 T G 12: 84,974,239 C98G probably benign Het
Hist1h2bb T C 13: 23,747,158 Y122H probably benign Het
Hltf G T 3: 20,082,930 Q417H possibly damaging Het
Hmg20b T C 10: 81,349,424 S35G probably benign Het
Igkv4-57-1 T G 6: 69,544,541 Y59S probably damaging Het
Irs2 C T 8: 11,005,061 V1124I possibly damaging Het
Kprp A G 3: 92,824,253 C497R unknown Het
Krt15 A T 11: 100,132,135 V418E probably benign Het
Lce1e G A 3: 92,708,005 P12S unknown Het
Lsmem1 T C 12: 40,177,114 D124G probably damaging Het
Morc3 T C 16: 93,845,148 F85S probably damaging Het
Mtnr1b A T 9: 15,863,151 V204E possibly damaging Het
Myo7b C T 18: 31,976,303 A1172T probably benign Het
Nbeal1 T A 1: 60,310,265 I2362N probably damaging Het
Nde1 T G 16: 14,188,391 L261R probably damaging Het
Neurl1b A G 17: 26,439,291 D401G probably benign Het
Nfkb2 T C 19: 46,308,400 V303A probably damaging Het
Nlrc5 C T 8: 94,473,024 P88S probably damaging Het
Olfr1280 T A 2: 111,316,115 I212K possibly damaging Het
Olfr286 T A 15: 98,227,031 I207F possibly damaging Het
Olfr772 T A 10: 129,174,296 M242L probably benign Het
Pde1c T A 6: 56,072,214 K705* probably null Het
Pear1 A T 3: 87,752,583 F699I probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Prickle1 A T 15: 93,502,980 L541* probably null Het
Prss39 G A 1: 34,499,263 G70S probably damaging Het
Prune2 T G 19: 17,216,344 N3065K probably damaging Het
Rdh5 A C 10: 128,918,068 D127E probably benign Het
Ryr3 G A 2: 112,834,267 H1580Y probably damaging Het
Sash1 G A 10: 8,762,230 probably benign Het
Scgb3a2 T A 18: 43,767,064 L139Q possibly damaging Het
Six1 A G 12: 73,046,321 S36P probably damaging Het
Slc30a5 T C 13: 100,813,908 I281V probably benign Het
Snai2 T A 16: 14,706,725 Y32N probably benign Het
Stat2 T C 10: 128,278,765 S244P probably damaging Het
Syne1 A G 10: 5,202,030 I5759T probably damaging Het
Tbc1d23 T C 16: 57,192,622 N329S possibly damaging Het
Tex2 A T 11: 106,544,388 S737R unknown Het
Trav13d-3 G A 14: 53,033,258 R59H probably benign Het
Tspan9 C T 6: 127,967,161 A59T probably benign Het
Usp53 G A 3: 122,953,269 A349V probably damaging Het
Vmn1r188 T C 13: 22,088,728 L284P probably damaging Het
Vmn2r85 T C 10: 130,425,346 N374S probably damaging Het
Zfp622 A T 15: 25,984,949 I134F probably damaging Het
Other mutations in Efcab5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Efcab5 APN 11 77137036 missense probably benign 0.04
IGL01343:Efcab5 APN 11 77129930 missense probably damaging 1.00
IGL02190:Efcab5 APN 11 77121314 missense probably benign 0.38
IGL02270:Efcab5 APN 11 77104313 missense probably damaging 0.97
IGL02572:Efcab5 APN 11 77137888 nonsense probably null
IGL02653:Efcab5 APN 11 77132022 missense probably damaging 0.99
IGL02818:Efcab5 APN 11 77105348 missense probably damaging 0.99
IGL03068:Efcab5 APN 11 77104101 missense probably benign
IGL03222:Efcab5 APN 11 77137367 missense probably benign 0.40
IGL03226:Efcab5 APN 11 77137675 missense possibly damaging 0.92
IGL03257:Efcab5 APN 11 77188770 missense probably damaging 0.99
PIT4131001:Efcab5 UTSW 11 77137691
PIT4418001:Efcab5 UTSW 11 77132051 missense possibly damaging 0.89
R0276:Efcab5 UTSW 11 77129876 missense probably damaging 1.00
R0276:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0277:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0284:Efcab5 UTSW 11 77103527 intron probably benign
R0386:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0386:Efcab5 UTSW 11 77172378 missense probably benign 0.30
R0966:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0968:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R1433:Efcab5 UTSW 11 77105378 missense probably benign 0.09
R1673:Efcab5 UTSW 11 77151853 missense probably damaging 0.99
R1842:Efcab5 UTSW 11 77134875 missense probably benign 0.00
R1848:Efcab5 UTSW 11 77103306 missense probably damaging 1.00
R2069:Efcab5 UTSW 11 77172321 missense probably benign 0.06
R3713:Efcab5 UTSW 11 77116182 missense probably damaging 1.00
R4012:Efcab5 UTSW 11 77117830 missense probably damaging 0.98
R4020:Efcab5 UTSW 11 77104104 missense probably benign 0.33
R4391:Efcab5 UTSW 11 77090458 missense probably damaging 0.99
R4392:Efcab5 UTSW 11 77090458 missense probably damaging 0.99
R4692:Efcab5 UTSW 11 77113681 missense probably damaging 1.00
R4929:Efcab5 UTSW 11 77103383 missense probably benign 0.36
R4985:Efcab5 UTSW 11 77138229 missense probably damaging 0.98
R4988:Efcab5 UTSW 11 77137252 missense probably damaging 1.00
R5246:Efcab5 UTSW 11 77188845 missense probably damaging 1.00
R5260:Efcab5 UTSW 11 77137651 missense possibly damaging 0.92
R5387:Efcab5 UTSW 11 77134842 missense possibly damaging 0.93
R5516:Efcab5 UTSW 11 77188789 missense possibly damaging 0.62
R5535:Efcab5 UTSW 11 77151921 missense probably damaging 1.00
R5694:Efcab5 UTSW 11 77188875 missense probably benign 0.09
R5922:Efcab5 UTSW 11 77188744 missense probably benign 0.44
R6030:Efcab5 UTSW 11 77121262 missense probably damaging 1.00
R6030:Efcab5 UTSW 11 77121262 missense probably damaging 1.00
R6183:Efcab5 UTSW 11 77137258 missense probably benign 0.04
R6437:Efcab5 UTSW 11 77137902 missense probably benign 0.25
R6442:Efcab5 UTSW 11 77105434 nonsense probably null
R6592:Efcab5 UTSW 11 77113610 missense possibly damaging 0.90
R6769:Efcab5 UTSW 11 77105432 missense probably damaging 0.98
R7257:Efcab5 UTSW 11 77137779 missense probably damaging 0.99
R7285:Efcab5 UTSW 11 77137344 missense probably benign
R7285:Efcab5 UTSW 11 77138215 missense possibly damaging 0.49
R7350:Efcab5 UTSW 11 77137561 missense probably benign 0.05
R7369:Efcab5 UTSW 11 77117835 missense possibly damaging 0.60
R7760:Efcab5 UTSW 11 77151926 missense probably benign 0.31
R8213:Efcab5 UTSW 11 77116071 missense probably damaging 1.00
R8690:Efcab5 UTSW 11 77103289 missense probably damaging 0.98
R9294:Efcab5 UTSW 11 77121238 missense probably benign 0.03
R9310:Efcab5 UTSW 11 77113705 missense probably benign 0.23
R9324:Efcab5 UTSW 11 77113720 missense possibly damaging 0.95
R9404:Efcab5 UTSW 11 77132108 missense probably damaging 0.99
R9407:Efcab5 UTSW 11 77132108 missense probably damaging 0.99
R9509:Efcab5 UTSW 11 77104151 missense possibly damaging 0.94
R9562:Efcab5 UTSW 11 77132108 missense probably damaging 0.99
X0061:Efcab5 UTSW 11 77116234 missense probably damaging 1.00
Z1176:Efcab5 UTSW 11 77132139 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGTTGTACATTTCTAAAGAGATGGC -3'
(R):5'- CAATGTGATGGGAGGCATCTG -3'

Sequencing Primer
(F):5'- TGGCACACTAGGAGGAAGAACC -3'
(R):5'- AACAGGTACCATAGGTTTTCCC -3'
Posted On 2022-05-16