Incidental Mutation 'R9515:Olfr1308'
ID 718437
Institutional Source Beutler Lab
Gene Symbol Olfr1308
Ensembl Gene ENSMUSG00000074952
Gene Name olfactory receptor 1308
Synonyms MOR245-22, GA_x6K02T2Q125-73008844-73007882
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R9515 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 111959285-111964944 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 111960239 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 278 (V278A)
Ref Sequence ENSEMBL: ENSMUSP00000146688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099605] [ENSMUST00000207560]
AlphaFold Q7TQX0
Predicted Effect possibly damaging
Transcript: ENSMUST00000099605
AA Change: V278A

PolyPhen 2 Score 0.535 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097200
Gene: ENSMUSG00000074952
AA Change: V278A

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 2.2e-39 PFAM
Pfam:7tm_1 41 287 3.1e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000207560
AA Change: V278A

PolyPhen 2 Score 0.535 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
Aamdc A G 7: 97,575,601 V18A probably benign Het
Adam12 T A 7: 133,907,644 I796F probably benign Het
Adcy7 T A 8: 88,311,018 V238E possibly damaging Het
Adgrv1 G A 13: 81,543,378 H1697Y probably damaging Het
Adrb1 A G 19: 56,723,393 D341G probably benign Het
Akap13 T C 7: 75,704,527 Y80H probably benign Het
Akap9 C T 5: 4,055,709 L2927F probably damaging Het
Alox8 T A 11: 69,185,124 D667V probably damaging Het
Arhgap30 A G 1: 171,408,434 E792G probably benign Het
Arhgef16 A G 4: 154,280,975 V561A possibly damaging Het
Bcap29 A T 12: 31,626,757 Y105N probably damaging Het
Best2 T A 8: 85,013,518 T6S Het
Bfsp2 C A 9: 103,480,052 V59L possibly damaging Het
Brd3 T A 2: 27,459,803 D246V Het
Btnl1 T A 17: 34,381,144 V207E probably benign Het
C87499 T A 4: 88,627,982 L374F possibly damaging Het
Ccdc122 T A 14: 77,091,968 Y154N Het
Cfap43 A G 19: 47,785,375 Y656H probably damaging Het
Clca3a2 A T 3: 144,803,047 Y670* probably null Het
Coprs T C 8: 13,885,081 Y158C probably damaging Het
Desi2 T G 1: 178,256,604 M106R unknown Het
Dnaaf3 T C 7: 4,528,101 E111G probably damaging Het
Epha10 T A 4: 124,881,911 F13I probably benign Het
Fam193a T A 5: 34,458,027 F813L possibly damaging Het
Fbn1 C A 2: 125,365,631 A981S probably benign Het
Gga2 T A 7: 122,012,225 T37S probably damaging Het
Glra3 T A 8: 56,125,264 F452Y probably damaging Het
Gm10338 T A 14: 7,594,512 N96I probably damaging Het
Gm6502 G A 5: 94,317,065 V437I probably benign Het
Gpd2 A T 2: 57,305,854 E149V possibly damaging Het
Gpr137c T G 14: 45,278,772 L321* probably null Het
Gsdmc2 T C 15: 63,830,829 I196M probably benign Het
Habp2 A G 19: 56,306,821 D48G probably benign Het
Hdc G T 2: 126,616,229 P58T probably damaging Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Hnrnpr G T 4: 136,336,304 V342F probably damaging Het
Hyal6 T A 6: 24,734,930 Y287* probably null Het
Igsf8 T C 1: 172,318,958 Y571H Het
Kalrn A G 16: 34,034,494 S1999P probably damaging Het
Lama2 T A 10: 27,001,174 N2672I probably benign Het
Lrrc7 T C 3: 158,161,468 R879G probably damaging Het
Lrwd1 T G 5: 136,131,559 H307P probably benign Het
Mau2 T C 8: 70,027,503 Y318C probably damaging Het
Med13 T C 11: 86,308,901 Q660R probably benign Het
Mepce G C 5: 137,785,497 P189R probably damaging Het
Mical3 T A 6: 121,024,797 N578I probably damaging Het
Mug1 T C 6: 121,884,676 S1366P probably damaging Het
Nol11 A T 11: 107,173,452 D511E possibly damaging Het
Obscn T A 11: 59,103,514 H1514L probably benign Het
Olfr1021-ps1 A T 2: 85,863,578 I56F probably damaging Het
Olfr1464-ps1 G A 19: 13,282,194 T288I unknown Het
Olfr1537 T C 9: 39,238,329 T32A probably benign Het
Olfr168 C T 16: 19,530,276 A215T probably benign Het
Olfr854 T C 9: 19,567,100 I95V possibly damaging Het
Olfr860 A G 9: 19,846,520 L33P possibly damaging Het
Onecut3 C A 10: 80,496,053 S349* probably null Het
Patl2 C T 2: 122,124,893 G297E probably benign Het
Pdlim5 G A 3: 142,304,350 T168M probably damaging Het
Pdzd2 A C 15: 12,374,535 L1838R probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pkd1l3 T C 8: 109,669,217 V2083A probably damaging Het
Pkhd1 T A 1: 20,567,517 Y348F probably damaging Het
Plekhg5 T A 4: 152,114,369 S1005T probably benign Het
Ppp4r1 T A 17: 65,835,078 N709K probably null Het
Reln T C 5: 21,920,510 D2725G possibly damaging Het
Rnf41 T A 10: 128,438,430 I317K probably benign Het
Rxfp2 T C 5: 150,055,979 V268A possibly damaging Het
Sema5a A G 15: 32,679,227 H884R probably damaging Het
Serpinh1 A T 7: 99,347,277 M236K probably damaging Het
Sh3pxd2a A G 19: 47,267,171 L1064P probably damaging Het
Skint6 T C 4: 112,858,178 H947R probably benign Het
Slc12a3 T A 8: 94,357,030 M895K possibly damaging Het
Slc22a3 C A 17: 12,507,170 R52L probably damaging Het
Slc38a1 A G 15: 96,590,084 L180P probably damaging Het
Slc4a3 T C 1: 75,556,968 V1078A probably damaging Het
Snx30 T A 4: 59,879,241 V160E probably damaging Het
Spata18 A T 5: 73,672,497 I332F Het
Stard9 C G 2: 120,704,083 P3607R probably damaging Het
Svep1 T A 4: 58,084,144 Y1876F possibly damaging Het
Sytl1 A G 4: 133,258,980 probably null Het
Tacc2 A C 7: 130,764,311 K567Q probably damaging Het
Tfr2 A G 5: 137,577,507 D295G possibly damaging Het
Tmem53 C A 4: 117,267,925 H78Q probably benign Het
Tnnt2 G A 1: 135,840,902 E10K unknown Het
Top2a T A 11: 99,012,144 I406F probably damaging Het
Ttc1 C A 11: 43,730,478 R292I Het
Ubr1 T G 2: 120,873,146 T1568P probably damaging Het
Usp25 T G 16: 77,055,188 V197G probably damaging Het
Usp9y A T Y: 1,432,188 N432K probably benign Het
Vmn2r26 T A 6: 124,061,178 Y571N probably damaging Het
Zfp7 T C 15: 76,891,284 S509P probably damaging Het
Other mutations in Olfr1308
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Olfr1308 APN 2 111960275 missense possibly damaging 0.84
IGL01359:Olfr1308 APN 2 111961061 missense probably benign
IGL01731:Olfr1308 APN 2 111960635 missense probably benign 0.03
IGL01788:Olfr1308 APN 2 111961007 missense probably benign
IGL02385:Olfr1308 APN 2 111960258 missense probably benign 0.00
IGL02969:Olfr1308 APN 2 111960567 missense probably damaging 1.00
R0102:Olfr1308 UTSW 2 111960597 missense probably damaging 1.00
R0102:Olfr1308 UTSW 2 111960597 missense probably damaging 1.00
R0244:Olfr1308 UTSW 2 111961016 missense probably benign 0.13
R0265:Olfr1308 UTSW 2 111960494 missense probably damaging 0.99
R1268:Olfr1308 UTSW 2 111960877 missense possibly damaging 0.78
R1406:Olfr1308 UTSW 2 111960581 missense probably benign 0.07
R1406:Olfr1308 UTSW 2 111960581 missense probably benign 0.07
R1568:Olfr1308 UTSW 2 111960240 missense probably benign 0.02
R2401:Olfr1308 UTSW 2 111960149 missense probably benign 0.01
R4396:Olfr1308 UTSW 2 111960215 missense probably damaging 1.00
R4528:Olfr1308 UTSW 2 111960948 missense probably damaging 1.00
R5916:Olfr1308 UTSW 2 111960830 missense probably damaging 1.00
R6332:Olfr1308 UTSW 2 111960746 missense probably damaging 0.98
R6595:Olfr1308 UTSW 2 111960170 missense possibly damaging 0.95
R7339:Olfr1308 UTSW 2 111960611 missense probably benign 0.12
R7917:Olfr1308 UTSW 2 111960965 missense probably damaging 0.98
R8017:Olfr1308 UTSW 2 111960573 missense probably damaging 0.99
R8092:Olfr1308 UTSW 2 111960307 missense probably benign 0.00
R8246:Olfr1308 UTSW 2 111960138 missense probably benign 0.05
R9389:Olfr1308 UTSW 2 111960527 missense probably damaging 1.00
R9631:Olfr1308 UTSW 2 111961032 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GCTTCCTTCAGAGAGATATTTGTCTG -3'
(R):5'- AACAGTGGATTCATGTCGGTTG -3'

Sequencing Primer
(F):5'- TGTCTGTACAAATTTAGACTTGCTG -3'
(R):5'- GGTTGGGTCCTTCTTCATACTGATC -3'
Posted On 2022-07-18