Incidental Mutation 'R0826:Olfr1250'
ID78211
Institutional Source Beutler Lab
Gene Symbol Olfr1250
Ensembl Gene ENSMUSG00000075078
Gene Nameolfactory receptor 1250
SynonymsGA_x6K02T2Q125-51098877-51097933, MOR231-7
MMRRC Submission 039006-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R0826 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89653773-89661467 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 89656837 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 201 (N201K)
Ref Sequence ENSEMBL: ENSMUSP00000149720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099768] [ENSMUST00000111527] [ENSMUST00000215730]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099768
AA Change: N201K

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097356
Gene: ENSMUSG00000075078
AA Change: N201K

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 1.1e-28 PFAM
Pfam:7tm_4 137 278 1e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111527
AA Change: N201K

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107152
Gene: ENSMUSG00000075078
AA Change: N201K

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.2e-50 PFAM
Pfam:7tm_1 39 285 8.1e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215730
AA Change: N201K

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.6%
  • 10x: 95.7%
  • 20x: 86.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4930563D23Rik G A 16: 92,321,187 S71L probably benign Het
4931406C07Rik T C 9: 15,291,996 probably null Het
Adamts16 T A 13: 70,768,692 D727V possibly damaging Het
Anxa10 A C 8: 62,076,284 L133* probably null Het
Arfgef3 G A 10: 18,589,666 T2143I probably damaging Het
Arhgef17 T C 7: 100,930,743 T333A probably benign Het
Arhgef40 A G 14: 52,000,993 T1310A probably benign Het
Atg10 C T 13: 90,936,586 probably null Het
Atp1a1 A G 3: 101,584,853 F569S probably damaging Het
Baiap3 A G 17: 25,245,229 W849R possibly damaging Het
Baz1a A T 12: 54,930,312 Y9* probably null Het
Catsperg2 C T 7: 29,705,624 D702N possibly damaging Het
Clasrp G T 7: 19,584,301 probably benign Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Col19a1 T C 1: 24,526,386 K288R unknown Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cttnbp2 A G 6: 18,405,178 probably benign Het
Dnah1 T A 14: 31,303,907 I828F probably benign Het
Dpf2 G T 19: 5,907,127 Q23K probably damaging Het
Dsc3 T A 18: 19,981,172 I342F probably damaging Het
Enpp3 A G 10: 24,795,716 L460P probably damaging Het
Epb41l2 A G 10: 25,504,192 E871G probably damaging Het
Exoc2 T C 13: 30,856,797 probably null Het
Fpr-rs7 A T 17: 20,113,626 S201T probably benign Het
Gtf2ird2 T C 5: 134,216,955 F685S probably damaging Het
Helz2 C T 2: 181,240,853 R49H possibly damaging Het
Ica1 A G 6: 8,667,375 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kif21a A G 15: 90,997,541 probably null Het
Lamb3 T A 1: 193,330,908 C480* probably null Het
Lamc2 A G 1: 153,152,082 S199P probably damaging Het
Lrfn3 T C 7: 30,360,251 N183S probably benign Het
Lsm14a C A 7: 34,371,045 probably benign Het
Mest C A 6: 30,742,814 H146Q probably damaging Het
Mmp27 T C 9: 7,579,009 V339A probably damaging Het
Myo16 T C 8: 10,376,285 probably benign Het
Myoz1 C T 14: 20,653,611 probably benign Het
Nlrp5 A G 7: 23,417,708 M286V probably benign Het
Olfr1386 A T 11: 49,470,331 Y60F probably damaging Het
Olfr1537 C T 9: 39,238,429 M1I probably null Het
Olfr273 C T 4: 52,855,566 V316I probably benign Het
Optc T C 1: 133,905,155 K69R probably benign Het
Osbpl3 A T 6: 50,346,377 M242K probably damaging Het
Pdzd9 T A 7: 120,668,401 S64C probably damaging Het
Pik3cg A G 12: 32,195,673 S859P possibly damaging Het
Ppp1r12a G T 10: 108,230,553 A202S possibly damaging Het
Rab32 A T 10: 10,550,867 F112I possibly damaging Het
Ror2 T C 13: 53,113,217 Y394C probably damaging Het
Rtn3 A G 19: 7,467,880 probably benign Het
Sbk1 C T 7: 126,291,835 P147L probably damaging Het
Shpk T A 11: 73,204,031 M91K probably damaging Het
Slco6c1 C T 1: 97,128,101 S25N probably benign Het
Snx2 A T 18: 53,194,522 T107S probably benign Het
Tle2 G A 10: 81,586,314 V397I possibly damaging Het
Tmem131l T C 3: 83,898,417 D1573G probably damaging Het
Tnfrsf8 A G 4: 145,285,138 probably benign Het
Tpmt T C 13: 47,041,489 E36G probably benign Het
Trim30c T A 7: 104,383,481 T257S probably benign Het
Tsc2 A G 17: 24,596,958 L150P probably benign Het
Ttc26 A G 6: 38,425,114 probably null Het
Upf3a G C 8: 13,798,338 G378A possibly damaging Het
Yeats2 A T 16: 20,193,216 K514* probably null Het
Zfp11 A G 5: 129,657,525 Y291H probably benign Het
Zfp457 T C 13: 67,293,314 D399G possibly damaging Het
Other mutations in Olfr1250
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Olfr1250 APN 2 89657076 missense probably damaging 0.98
IGL01608:Olfr1250 APN 2 89656491 utr 3 prime probably benign
IGL01913:Olfr1250 APN 2 89657340 missense probably benign 0.01
IGL02458:Olfr1250 APN 2 89657348 missense probably damaging 1.00
R0102:Olfr1250 UTSW 2 89656655 missense probably benign 0.10
R0621:Olfr1250 UTSW 2 89657115 nonsense probably null
R5460:Olfr1250 UTSW 2 89657070 missense probably damaging 1.00
R5720:Olfr1250 UTSW 2 89656955 missense probably benign 0.20
R6044:Olfr1250 UTSW 2 89657172 missense probably damaging 1.00
R6965:Olfr1250 UTSW 2 89656665 missense probably damaging 1.00
R7069:Olfr1250 UTSW 2 89656566 missense probably benign 0.00
R7305:Olfr1250 UTSW 2 89656502 missense probably benign
R8058:Olfr1250 UTSW 2 89657327 missense probably benign 0.01
Z1177:Olfr1250 UTSW 2 89656934 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGCTTATATCCACTGCACTCAC -3'
(R):5'- GGATTTGCACATGCTCTGCTTCAAG -3'

Sequencing Primer
(F):5'- GCAAACCTCTTTCAAAGTCAAGTG -3'
(R):5'- GCACATGCTCTGCTTCAAGTTATC -3'
Posted On2013-10-16