Incidental Mutation 'R0826:Tpmt'
List |< first << previous [record 59 of 66] next >> last >|
ID78252
Institutional Source Beutler Lab
Gene Symbol Tpmt
Ensembl Gene ENSMUSG00000021376
Gene Namethiopurine methyltransferase
Synonyms
MMRRC Submission 039006-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0826 (G1)
Quality Score213
Status Validated
Chromosome13
Chromosomal Location47022482-47044737 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47041489 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 36 (E36G)
Ref Sequence ENSEMBL: ENSMUSP00000115361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021806] [ENSMUST00000037025] [ENSMUST00000110118] [ENSMUST00000124948] [ENSMUST00000136864] [ENSMUST00000143868] [ENSMUST00000154802]
Predicted Effect probably benign
Transcript: ENSMUST00000021806
AA Change: E12G

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000021806
Gene: ENSMUSG00000021376
AA Change: E12G

DomainStartEndE-ValueType
Pfam:TPMT 19 240 4.1e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037025
SMART Domains Protein: ENSMUSP00000038373
Gene: ENSMUSG00000038080

DomainStartEndE-ValueType
Pfam:zf-CW 138 191 2.6e-13 PFAM
low complexity region 235 253 N/A INTRINSIC
Pfam:SWIRM 286 369 6e-12 PFAM
Pfam:Pyr_redox_2 368 490 3.1e-8 PFAM
Pfam:Thi4 375 446 2.2e-10 PFAM
Pfam:FAD_binding_3 388 423 4.1e-7 PFAM
Pfam:HI0933_like 389 428 1.6e-7 PFAM
Pfam:FAD_binding_2 390 428 1.6e-6 PFAM
Pfam:Pyr_redox 390 438 8e-8 PFAM
Pfam:NAD_binding_8 393 460 1.6e-13 PFAM
Pfam:Amino_oxidase 398 824 3.7e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110118
AA Change: E12G

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000105745
Gene: ENSMUSG00000021376
AA Change: E12G

DomainStartEndE-ValueType
Pfam:TPMT 19 205 8.8e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124948
AA Change: E36G

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000115361
Gene: ENSMUSG00000021376
AA Change: E36G

DomainStartEndE-ValueType
Pfam:TPMT 43 93 2.4e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133100
Predicted Effect probably benign
Transcript: ENSMUST00000136864
AA Change: E12G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000120081
Gene: ENSMUSG00000021376
AA Change: E12G

DomainStartEndE-ValueType
Pfam:TPMT 19 188 3.6e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143868
SMART Domains Protein: ENSMUSP00000117793
Gene: ENSMUSG00000038080

DomainStartEndE-ValueType
Pfam:zf-CW 137 175 3.6e-13 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000151509
AA Change: E31G
SMART Domains Protein: ENSMUSP00000120564
Gene: ENSMUSG00000021376
AA Change: E31G

DomainStartEndE-ValueType
Pfam:TPMT 19 73 3.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154802
AA Change: E12G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000121827
Gene: ENSMUSG00000021376
AA Change: E12G

DomainStartEndE-ValueType
Pfam:TPMT 19 182 2.9e-62 PFAM
Meta Mutation Damage Score 0.0597 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.6%
  • 10x: 95.7%
  • 20x: 86.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme that metabolizes thiopurine drugs via S-adenosyl-L-methionine as the S-methyl donor and S-adenosyl-L-homocysteine as a byproduct. Thiopurine drugs such as 6-mercaptopurine are used as chemotherapeutic agents. Genetic polymorphisms that affect this enzymatic activity are correlated with variations in sensitivity and toxicity to such drugs within individuals, causing thiopurine S-methyltransferase deficiency. Related pseudogenes have been identified on chromosomes 3, 18 and X. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygous and heterozygous mutation of this gene results in increased sensitivity to mercaptopurine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4930563D23Rik G A 16: 92,321,187 S71L probably benign Het
4931406C07Rik T C 9: 15,291,996 probably null Het
Adamts16 T A 13: 70,768,692 D727V possibly damaging Het
Anxa10 A C 8: 62,076,284 L133* probably null Het
Arfgef3 G A 10: 18,589,666 T2143I probably damaging Het
Arhgef17 T C 7: 100,930,743 T333A probably benign Het
Arhgef40 A G 14: 52,000,993 T1310A probably benign Het
Atg10 C T 13: 90,936,586 probably null Het
Atp1a1 A G 3: 101,584,853 F569S probably damaging Het
Baiap3 A G 17: 25,245,229 W849R possibly damaging Het
Baz1a A T 12: 54,930,312 Y9* probably null Het
Catsperg2 C T 7: 29,705,624 D702N possibly damaging Het
Clasrp G T 7: 19,584,301 probably benign Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Col19a1 T C 1: 24,526,386 K288R unknown Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cttnbp2 A G 6: 18,405,178 probably benign Het
Dnah1 T A 14: 31,303,907 I828F probably benign Het
Dpf2 G T 19: 5,907,127 Q23K probably damaging Het
Dsc3 T A 18: 19,981,172 I342F probably damaging Het
Enpp3 A G 10: 24,795,716 L460P probably damaging Het
Epb41l2 A G 10: 25,504,192 E871G probably damaging Het
Exoc2 T C 13: 30,856,797 probably null Het
Fpr-rs7 A T 17: 20,113,626 S201T probably benign Het
Gtf2ird2 T C 5: 134,216,955 F685S probably damaging Het
Helz2 C T 2: 181,240,853 R49H possibly damaging Het
Ica1 A G 6: 8,667,375 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kif21a A G 15: 90,997,541 probably null Het
Lamb3 T A 1: 193,330,908 C480* probably null Het
Lamc2 A G 1: 153,152,082 S199P probably damaging Het
Lrfn3 T C 7: 30,360,251 N183S probably benign Het
Lsm14a C A 7: 34,371,045 probably benign Het
Mest C A 6: 30,742,814 H146Q probably damaging Het
Mmp27 T C 9: 7,579,009 V339A probably damaging Het
Myo16 T C 8: 10,376,285 probably benign Het
Myoz1 C T 14: 20,653,611 probably benign Het
Nlrp5 A G 7: 23,417,708 M286V probably benign Het
Olfr1250 A C 2: 89,656,837 N201K possibly damaging Het
Olfr1386 A T 11: 49,470,331 Y60F probably damaging Het
Olfr1537 C T 9: 39,238,429 M1I probably null Het
Olfr273 C T 4: 52,855,566 V316I probably benign Het
Optc T C 1: 133,905,155 K69R probably benign Het
Osbpl3 A T 6: 50,346,377 M242K probably damaging Het
Pdzd9 T A 7: 120,668,401 S64C probably damaging Het
Pik3cg A G 12: 32,195,673 S859P possibly damaging Het
Ppp1r12a G T 10: 108,230,553 A202S possibly damaging Het
Rab32 A T 10: 10,550,867 F112I possibly damaging Het
Ror2 T C 13: 53,113,217 Y394C probably damaging Het
Rtn3 A G 19: 7,467,880 probably benign Het
Sbk1 C T 7: 126,291,835 P147L probably damaging Het
Shpk T A 11: 73,204,031 M91K probably damaging Het
Slco6c1 C T 1: 97,128,101 S25N probably benign Het
Snx2 A T 18: 53,194,522 T107S probably benign Het
Tle2 G A 10: 81,586,314 V397I possibly damaging Het
Tmem131l T C 3: 83,898,417 D1573G probably damaging Het
Tnfrsf8 A G 4: 145,285,138 probably benign Het
Trim30c T A 7: 104,383,481 T257S probably benign Het
Tsc2 A G 17: 24,596,958 L150P probably benign Het
Ttc26 A G 6: 38,425,114 probably null Het
Upf3a G C 8: 13,798,338 G378A possibly damaging Het
Yeats2 A T 16: 20,193,216 K514* probably null Het
Zfp11 A G 5: 129,657,525 Y291H probably benign Het
Zfp457 T C 13: 67,293,314 D399G possibly damaging Het
Other mutations in Tpmt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02865:Tpmt APN 13 47025402 missense probably benign 0.16
R0666:Tpmt UTSW 13 47032454 missense probably damaging 1.00
R1373:Tpmt UTSW 13 47027258 unclassified probably null
R1640:Tpmt UTSW 13 47027283 nonsense probably null
R5644:Tpmt UTSW 13 47028959 missense probably benign 0.41
R6086:Tpmt UTSW 13 47035030 missense probably damaging 0.99
R6228:Tpmt UTSW 13 47027259 missense probably benign 0.00
R6372:Tpmt UTSW 13 47035894 critical splice donor site probably null
R7035:Tpmt UTSW 13 47040108 missense probably damaging 1.00
R7325:Tpmt UTSW 13 47041484 nonsense probably null
R7886:Tpmt UTSW 13 47040162 missense probably damaging 1.00
R7969:Tpmt UTSW 13 47040162 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTAACGATATGAGATGACAGTGTGT -3'
(R):5'- GGGCAGGTTGGAACTGTGGAATT -3'

Sequencing Primer
(F):5'- atttctaatgcttttgtttccatctc -3'
(R):5'- ttacagacagccacgagac -3'
Posted On2013-10-16