Incidental Mutation 'R0815:Thnsl2'
ID78567
Institutional Source Beutler Lab
Gene Symbol Thnsl2
Ensembl Gene ENSMUSG00000054474
Gene Namethreonine synthase-like 2 (bacterial)
SynonymsTSH2
MMRRC Submission 038995-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R0815 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location71128166-71144439 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 71134224 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 220 (L220*)
Ref Sequence ENSEMBL: ENSMUSP00000124423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074241] [ENSMUST00000160918]
Predicted Effect probably null
Transcript: ENSMUST00000074241
AA Change: L220*
SMART Domains Protein: ENSMUSP00000073861
Gene: ENSMUSG00000054474
AA Change: L220*

DomainStartEndE-ValueType
Pfam:Thr_synth_N 2 81 2.4e-27 PFAM
Pfam:PALP 93 415 9.6e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000160918
AA Change: L220*
SMART Domains Protein: ENSMUSP00000124423
Gene: ENSMUSG00000054474
AA Change: L220*

DomainStartEndE-ValueType
Pfam:Thr_synth_N 2 81 1.1e-27 PFAM
Pfam:PALP 94 413 8.4e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170455
Predicted Effect probably benign
Transcript: ENSMUST00000170753
SMART Domains Protein: ENSMUSP00000129994
Gene: ENSMUSG00000054474

DomainStartEndE-ValueType
PDB:4F4F|B 2 122 1e-11 PDB
SCOP:d1kl7a_ 2 129 1e-10 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.5%
  • 20x: 91.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a threonine synthase-like protein. A similar enzyme in mouse can catalyze the degradation of O-phospho-homoserine to a-ketobutyrate, phosphate, and ammonia. This protein also has phospho-lyase activity on both gamma and beta phosphorylated substrates. In mouse an alternatively spliced form of this protein has been shown to act as a cytokine and can induce the production of the inflammatory cytokine IL6 in osteoblasts. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,351,087 I88L possibly damaging Het
Abcb5 A G 12: 118,901,449 probably benign Het
Abcf2 A T 5: 24,567,270 Y487N probably damaging Het
Adcy4 T C 14: 55,783,599 Y27C probably damaging Het
Atp2a2 T C 5: 122,471,236 I188V probably benign Het
Cacna1s A T 1: 136,112,957 I1231F possibly damaging Het
Capn7 T A 14: 31,369,757 C704S possibly damaging Het
Celsr2 G T 3: 108,401,301 T1770K possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cul9 T C 17: 46,537,822 probably null Het
Dpp10 A G 1: 123,432,929 probably null Het
Dscaml1 A G 9: 45,745,074 I1571V probably benign Het
Eif3j2 T A 18: 43,476,971 Y259F probably benign Het
Erc2 A C 14: 28,025,148 N345T probably benign Het
Fbxo21 T C 5: 117,995,508 probably benign Het
Frmd8 A T 19: 5,865,056 probably benign Het
Gfm1 T C 3: 67,474,595 S705P probably damaging Het
Gucy1b2 T C 14: 62,419,062 D282G probably benign Het
H2-Ab1 T C 17: 34,267,354 I129T probably damaging Het
H2-M10.3 T A 17: 36,366,690 Y232F probably damaging Het
Lipm A T 19: 34,118,761 T326S probably benign Het
Lrrc8c T C 5: 105,608,534 L725P probably damaging Het
Map3k19 A G 1: 127,834,638 probably benign Het
Med31 T A 11: 72,213,831 N50I probably damaging Het
Mgea5 C T 19: 45,782,986 A49T probably benign Het
Myo15b T G 11: 115,866,336 probably benign Het
Nemp1 T C 10: 127,693,024 L199S probably damaging Het
Nod2 G A 8: 88,672,662 probably benign Het
Olfr1444 A G 19: 12,862,644 I290V probably benign Het
Olfr319 A G 11: 58,702,609 R303G possibly damaging Het
Parva G A 7: 112,567,864 V215M probably damaging Het
Phf1 T C 17: 26,937,140 probably benign Het
Ppp1r12c G T 7: 4,486,366 Q240K probably damaging Het
Ralgapa1 A T 12: 55,762,681 Y436* probably null Het
Ralgapa1 C A 12: 55,782,777 probably benign Het
Rbm11 C T 16: 75,596,637 R74C probably damaging Het
Robo3 A G 9: 37,422,183 V744A probably damaging Het
Rsbn1 T G 3: 103,954,153 S522A probably damaging Het
Scel T A 14: 103,586,480 S381R possibly damaging Het
Sec31b G A 19: 44,518,173 Q909* probably null Het
Slc38a11 T A 2: 65,353,780 I176L possibly damaging Het
Slc39a4 C T 15: 76,612,639 D574N probably damaging Het
Slc44a1 T G 4: 53,536,421 V199G possibly damaging Het
Sltm A G 9: 70,561,908 T150A probably benign Het
Son C A 16: 91,655,484 A373D probably damaging Het
Sp140 C T 1: 85,620,051 probably benign Het
Speg A G 1: 75,415,392 Y1606C probably damaging Het
Srgap1 A T 10: 121,785,474 V1061D probably damaging Het
Stat5a A G 11: 100,875,082 probably null Het
Supt4a T A 11: 87,737,583 probably benign Het
Teddm1b A G 1: 153,874,892 K149R possibly damaging Het
Tinf2 G A 14: 55,680,109 P308S probably benign Het
Tmem131l A G 3: 83,940,572 S329P probably benign Het
Tnf T C 17: 35,201,144 probably benign Het
Upp2 A G 2: 58,771,556 T144A probably benign Het
Vmn2r94 T G 17: 18,257,711 Q146P probably damaging Het
Zfhx4 T A 3: 5,245,315 S919R possibly damaging Het
Other mutations in Thnsl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Thnsl2 APN 6 71131900 missense probably damaging 1.00
IGL00814:Thnsl2 APN 6 71139883 missense probably damaging 1.00
IGL01139:Thnsl2 APN 6 71138734 missense probably damaging 1.00
IGL01380:Thnsl2 APN 6 71138756 missense probably benign
IGL01511:Thnsl2 APN 6 71139793 missense probably benign 0.04
IGL02000:Thnsl2 APN 6 71134219 missense probably damaging 1.00
IGL03157:Thnsl2 APN 6 71131946 missense probably benign 0.00
R0372:Thnsl2 UTSW 6 71139790 missense probably damaging 1.00
R0380:Thnsl2 UTSW 6 71141330 missense probably damaging 1.00
R0521:Thnsl2 UTSW 6 71134259 missense probably damaging 1.00
R0863:Thnsl2 UTSW 6 71134224 nonsense probably null
R1300:Thnsl2 UTSW 6 71134191 missense probably damaging 1.00
R2867:Thnsl2 UTSW 6 71131961 missense probably damaging 1.00
R2867:Thnsl2 UTSW 6 71131961 missense probably damaging 1.00
R4767:Thnsl2 UTSW 6 71134295 missense probably damaging 1.00
R5578:Thnsl2 UTSW 6 71138765 missense probably benign 0.40
R5818:Thnsl2 UTSW 6 71134143 missense probably benign 0.01
R6627:Thnsl2 UTSW 6 71134215 missense possibly damaging 0.70
R6800:Thnsl2 UTSW 6 71141280 missense probably benign 0.29
R7192:Thnsl2 UTSW 6 71139755 missense probably benign 0.02
R7391:Thnsl2 UTSW 6 71131930 missense probably damaging 1.00
R7516:Thnsl2 UTSW 6 71132006 nonsense probably null
R7565:Thnsl2 UTSW 6 71141327 missense probably benign 0.00
R7980:Thnsl2 UTSW 6 71138668 missense probably damaging 1.00
R7988:Thnsl2 UTSW 6 71141319 missense probably benign 0.38
R8170:Thnsl2 UTSW 6 71129333 missense probably benign 0.05
X0021:Thnsl2 UTSW 6 71128704 missense probably benign 0.02
X0066:Thnsl2 UTSW 6 71139837 nonsense probably null
Z1177:Thnsl2 UTSW 6 71128841 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCAAAGTCCGTTTGCATCCCAG -3'
(R):5'- TGGGTTCAATCCCTAAGGAGCTTACAC -3'

Sequencing Primer
(F):5'- AGGGTCTCCTTACCTGCAAG -3'
(R):5'- CTAAGGAGCTTACACGGAGCC -3'
Posted On2013-10-16