Incidental Mutation 'R1070:Olfr193'
ID86185
Institutional Source Beutler Lab
Gene Symbol Olfr193
Ensembl Gene ENSMUSG00000060057
Gene Nameolfactory receptor 193
SynonymsOlfr1540-ps1, MOR183-7P, GA_x54KRFPKG5P-55338697-55337768, MOR113-7P, MOR113-7P
MMRRC Submission 039156-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R1070 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location59107924-59111881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59109819 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 264 (S264P)
Ref Sequence ENSEMBL: ENSMUSP00000146393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076262] [ENSMUST00000207935] [ENSMUST00000208455]
Predicted Effect probably benign
Transcript: ENSMUST00000076262
AA Change: S264P

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000075611
Gene: ENSMUSG00000060057
AA Change: S264P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.3e-48 PFAM
Pfam:7tm_1 41 290 5.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207935
Predicted Effect probably benign
Transcript: ENSMUST00000208455
AA Change: S264P

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.2765 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,543,300 D1367G probably damaging Het
Actr3b A G 5: 25,848,493 probably benign Het
Agtr1b A T 3: 20,315,748 N231K probably benign Het
AW549877 C A 15: 3,986,366 V239F probably benign Het
Bach1 T C 16: 87,720,121 S517P probably benign Het
Blzf1 A G 1: 164,303,930 probably benign Het
Bptf G T 11: 107,055,055 Q2453K possibly damaging Het
Gm853 T C 4: 130,219,156 E149G probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Heatr4 T C 12: 83,978,067 T327A possibly damaging Het
Hes1 T C 16: 30,067,283 I235T probably damaging Het
Hmcn1 T A 1: 150,689,590 D2262V probably damaging Het
Ifi208 C T 1: 173,683,044 A255V probably damaging Het
Inhbe T C 10: 127,351,513 I11M probably benign Het
Ipo9 T C 1: 135,406,543 E315G possibly damaging Het
Itih1 G T 14: 30,942,456 probably benign Het
Kcnk2 A G 1: 189,256,763 probably benign Het
Kdm4c T A 4: 74,373,628 Y827* probably null Het
Kif5a T C 10: 127,245,406 T220A probably benign Het
Krt78 A G 15: 101,946,293 Y1028H possibly damaging Het
Mylk4 T C 13: 32,724,818 D333G probably benign Het
Net1 A T 13: 3,912,930 S45T probably benign Het
Npat T A 9: 53,572,592 F1403I probably damaging Het
Olfr1351 C T 10: 79,017,850 P176L probably damaging Het
Olfr480 T C 7: 108,066,651 D49G probably benign Het
Pcif1 T C 2: 164,889,138 Y404H probably benign Het
Pdzd2 A G 15: 12,389,966 probably null Het
Rab3a A G 8: 70,757,194 N40S probably damaging Het
Raf1 T C 6: 115,637,699 N74D probably benign Het
Rap1gap2 A G 11: 74,437,027 V139A possibly damaging Het
Rdh12 T C 12: 79,213,748 L206P probably damaging Het
Sdhb T C 4: 140,971,236 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Strip1 T C 3: 107,627,408 E102G possibly damaging Het
Sult2a8 T A 7: 14,413,773 I198F probably damaging Het
Tarsl2 T C 7: 65,655,696 S223P probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vcam1 C T 3: 116,110,903 V732M possibly damaging Het
Vmn2r79 T C 7: 87,003,473 Y458H probably damaging Het
Other mutations in Olfr193
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Olfr193 APN 16 59110598 missense probably benign
IGL01613:Olfr193 APN 16 59109921 missense probably damaging 1.00
IGL02280:Olfr193 APN 16 59110332 missense probably damaging 1.00
IGL02533:Olfr193 APN 16 59109684 missense probably benign
IGL02544:Olfr193 APN 16 59110144 missense probably damaging 1.00
IGL02576:Olfr193 APN 16 59109771 missense probably benign
IGL02719:Olfr193 APN 16 59110173 missense probably benign 0.01
IGL03215:Olfr193 APN 16 59109962 missense possibly damaging 0.46
IGL03272:Olfr193 APN 16 59110556 missense probably benign 0.01
PIT4802001:Olfr193 UTSW 16 59110601 missense probably benign
R0544:Olfr193 UTSW 16 59110225 missense probably benign 0.03
R0783:Olfr193 UTSW 16 59110169 nonsense probably null
R1211:Olfr193 UTSW 16 59110160 missense possibly damaging 0.68
R1662:Olfr193 UTSW 16 59110604 missense probably benign 0.00
R1754:Olfr193 UTSW 16 59110581 missense probably benign 0.03
R1765:Olfr193 UTSW 16 59109755 missense probably damaging 1.00
R1937:Olfr193 UTSW 16 59109794 missense probably benign 0.11
R2875:Olfr193 UTSW 16 59109802 missense probably benign 0.01
R2910:Olfr193 UTSW 16 59110181 missense probably benign 0.00
R2911:Olfr193 UTSW 16 59110181 missense probably benign 0.00
R5084:Olfr193 UTSW 16 59110073 missense possibly damaging 0.90
R5700:Olfr193 UTSW 16 59109993 missense probably damaging 0.99
R7018:Olfr193 UTSW 16 59110607 start codon destroyed probably null 0.98
R7083:Olfr193 UTSW 16 59110037 missense probably damaging 1.00
R7572:Olfr193 UTSW 16 59110430 missense probably damaging 1.00
R7720:Olfr193 UTSW 16 59109771 missense probably benign
R8045:Olfr193 UTSW 16 59110039 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCACATTAAGTCTGCACCTATTTGC -3'
(R):5'- ACCACGGAATGTTTTCTTTTGGCATC -3'

Sequencing Primer
(F):5'- GCCATGTTTTAATAAGTTCATGACAG -3'
(R):5'- GCATCAATGGCCTATGATCGC -3'
Posted On2013-11-18