Incidental Mutation 'R1123:Evi5'
ID95844
Institutional Source Beutler Lab
Gene Symbol Evi5
Ensembl Gene ENSMUSG00000011831
Gene Nameecotropic viral integration site 5
SynonymsNB4S
MMRRC Submission 039196-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1123 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location107744795-107875107 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 107820578 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 184 (I184L)
Ref Sequence ENSEMBL: ENSMUSP00000108261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112642] [ENSMUST00000124034] [ENSMUST00000128723] [ENSMUST00000138111] [ENSMUST00000155955]
Predicted Effect probably benign
Transcript: ENSMUST00000112642
AA Change: I184L

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000108261
Gene: ENSMUSG00000011831
AA Change: I184L

DomainStartEndE-ValueType
low complexity region 51 80 N/A INTRINSIC
Blast:TBC 81 157 2e-16 BLAST
TBC 160 371 7.92e-91 SMART
internal_repeat_1 450 477 8.83e-6 PROSPERO
internal_repeat_1 494 521 8.83e-6 PROSPERO
coiled coil region 555 717 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124034
AA Change: I140L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121761
Gene: ENSMUSG00000011831
AA Change: I140L

DomainStartEndE-ValueType
low complexity region 7 36 N/A INTRINSIC
Blast:TBC 37 113 3e-17 BLAST
TBC 116 327 7.92e-91 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127579
Predicted Effect probably benign
Transcript: ENSMUST00000128723
AA Change: I140L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000114845
Gene: ENSMUSG00000011831
AA Change: I140L

DomainStartEndE-ValueType
low complexity region 7 36 N/A INTRINSIC
Blast:TBC 37 113 2e-16 BLAST
TBC 116 327 7.92e-91 SMART
internal_repeat_1 466 493 2.66e-6 PROSPERO
internal_repeat_1 510 537 2.66e-6 PROSPERO
coiled coil region 571 660 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132482
Predicted Effect probably benign
Transcript: ENSMUST00000138111
AA Change: I140L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119196
Gene: ENSMUSG00000011831
AA Change: I140L

DomainStartEndE-ValueType
low complexity region 7 36 N/A INTRINSIC
Blast:TBC 37 113 3e-17 BLAST
TBC 116 327 7.92e-91 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141673
Predicted Effect probably benign
Transcript: ENSMUST00000155955
AA Change: I168L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000119758
Gene: ENSMUSG00000011831
AA Change: I168L

DomainStartEndE-ValueType
Blast:TBC 18 133 3e-20 BLAST
Pfam:RabGAP-TBC 150 222 1.6e-11 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,264,080 M987K probably benign Het
Akap3 A G 6: 126,865,966 D516G probably benign Het
Arhgap12 A C 18: 6,031,822 V573G probably damaging Het
BC005561 T C 5: 104,518,470 L286P probably damaging Het
Ccdc122 T C 14: 77,067,911 S2P probably damaging Het
Cel T C 2: 28,556,740 Y473C probably damaging Het
Cfap157 C T 2: 32,777,923 V469M possibly damaging Het
Cyp2c40 C G 19: 39,812,677 V45L probably benign Het
Dtx3l C T 16: 35,933,268 A323T probably damaging Het
Erap1 A G 13: 74,673,643 T706A probably benign Het
Esyt1 A T 10: 128,516,558 V728E probably benign Het
Etnk2 A G 1: 133,373,272 D259G probably benign Het
Fem1a G C 17: 56,257,791 D295H probably damaging Het
Hectd4 T C 5: 121,286,736 F83S probably damaging Het
Hephl1 T C 9: 15,080,140 T601A probably benign Het
Isoc1 T C 18: 58,671,623 V201A probably benign Het
Kcnt2 A T 1: 140,573,608 D830V probably damaging Het
Lrfn1 G T 7: 28,467,119 C646F possibly damaging Het
Nbeal1 T C 1: 60,260,269 Y1255H probably benign Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Olfr1154 A C 2: 87,902,904 I257M probably damaging Het
Olfr1225 A G 2: 89,170,868 S115P possibly damaging Het
Olfr180 A T 16: 58,916,334 Y102* probably null Het
Pik3r4 G A 9: 105,663,129 A739T probably benign Het
Prpf8 T C 11: 75,495,285 V920A probably damaging Het
Slc16a7 A C 10: 125,231,147 S208A probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc35g2 A T 9: 100,552,994 I208N probably damaging Het
Suclg1 A G 6: 73,256,227 I51V probably benign Het
Other mutations in Evi5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01142:Evi5 APN 5 107815611 missense probably benign 0.05
IGL01458:Evi5 APN 5 107815647 missense probably damaging 1.00
IGL01615:Evi5 APN 5 107764707 missense probably damaging 1.00
IGL01939:Evi5 APN 5 107816924 unclassified probably benign
IGL02170:Evi5 APN 5 107821884 missense probably benign 0.45
IGL02539:Evi5 APN 5 107815665 missense probably benign 0.09
IGL02655:Evi5 APN 5 107813580 missense probably benign 0.36
IGL03040:Evi5 APN 5 107821806 missense probably damaging 1.00
IGL03058:Evi5 APN 5 107748151 missense probably damaging 0.98
R0125:Evi5 UTSW 5 107795772 missense probably benign 0.06
R0172:Evi5 UTSW 5 107790462 missense probably benign
R0334:Evi5 UTSW 5 107820535 missense probably damaging 0.97
R0335:Evi5 UTSW 5 107812411 missense probably benign 0.06
R0526:Evi5 UTSW 5 107821748 missense probably benign 0.44
R0579:Evi5 UTSW 5 107821709 missense probably benign 0.36
R0585:Evi5 UTSW 5 107813536 unclassified probably benign
R1618:Evi5 UTSW 5 107799118 splice site probably benign
R1699:Evi5 UTSW 5 107818920 missense probably damaging 1.00
R1772:Evi5 UTSW 5 107795841 missense probably benign 0.32
R1969:Evi5 UTSW 5 107748364 missense probably benign 0.04
R1977:Evi5 UTSW 5 107799139 nonsense probably null
R2010:Evi5 UTSW 5 107813545 critical splice donor site probably null
R3736:Evi5 UTSW 5 107818983 missense probably damaging 0.98
R5047:Evi5 UTSW 5 107821874 missense probably damaging 1.00
R5252:Evi5 UTSW 5 107795752 missense probably benign
R5350:Evi5 UTSW 5 107815678 missense probably benign 0.08
R5552:Evi5 UTSW 5 107818989 missense probably damaging 1.00
R5594:Evi5 UTSW 5 107820451 missense possibly damaging 0.84
R5895:Evi5 UTSW 5 107820436 missense probably damaging 1.00
R6334:Evi5 UTSW 5 107820521 nonsense probably null
R6364:Evi5 UTSW 5 107842113 missense probably damaging 1.00
R6838:Evi5 UTSW 5 107842161 missense possibly damaging 0.94
R6861:Evi5 UTSW 5 107748318 missense probably benign 0.00
R7032:Evi5 UTSW 5 107788281 missense probably benign 0.14
R7386:Evi5 UTSW 5 107809823 splice site probably null
R7844:Evi5 UTSW 5 107874994 missense probably benign 0.00
R8248:Evi5 UTSW 5 107818887 critical splice donor site probably null
R8298:Evi5 UTSW 5 107816865 missense possibly damaging 0.53
X0018:Evi5 UTSW 5 107818887 critical splice donor site probably null
X0027:Evi5 UTSW 5 107764762 missense probably damaging 0.98
Z1177:Evi5 UTSW 5 107748379 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGAACCTGCAATGCTCAGTCAGAG -3'
(R):5'- GCAGCCCTTTAAATGTGATGGTGC -3'

Sequencing Primer
(F):5'- CATGATGGGAATTCACGCTTC -3'
(R):5'- TCACGCCTTGAAAGGCTATG -3'
Posted On2014-01-05