Phenotypic Mutation 'water'

• Allele: water
• Mutation Type: missense
• Chromosome: 4
• Coordinate: 3,748,787 bp (GRCm39)
• Base Change: C ⇒ T (forward strand)
• Gene: Lyn
• Gene Name: LYN proto-oncogene, Src family tyrosine kinase
• Synonym(s): Hck-2, Yamaguchi sarcoma viral (v-yes-1) oncogene homolog
• Chromosomal Location: 3,676,865-3,791,612 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine protein kinase, which maybe involved in the regulation of mast cell degranulation, and erythroid differentiation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011] ; PHENOTYPE: Homozygotes for targeted null mutations exhibit splenomegaly, reduced numbers of peripheral B cells, impaired immune responses, IgM hyperglobulinemia, autoimmunity with glomerulonephritis, and monocyte/macrophage tumors. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Alanine changed to Valine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000038838] [ENSMUSP00000100075]
• AlphaFold: P25911
• PDB Structure: Lyn Tyrosine Kinase Domain, apo form [X-RAY DIFFRACTION] ; Lyn Tyrosine Kinase Domain-AMP-PNP complex [X-RAY DIFFRACTION] ; Lyn Tyrosine Kinase Domain-PP2 complex [X-RAY DIFFRACTION] ; Lyn Tyrosine Kinase Domain-Dasatinib complex [X-RAY DIFFRACTION] ; Structure of unliganded Lyn SH2 domain [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000038838; Gene: ENSMUSG00000042228; AA Change: A255V

Domain	Start	End	E-Value	Type
SH3	66	122	9.24e-21	SMART
SH2	127	217	5.38e-33	SMART
TyrKc	247	497	3.25e-137	SMART

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
  (Using ENSMUST00000041377)
• SMART Domains: Protein: ENSMUSP00000100075; Gene: ENSMUSG00000042228; AA Change: A234V

Domain	Start	End	E-Value	Type
SH3	45	101	5.8e-23	SMART
SH2	106	196	3.3e-35	SMART
TyrKc	226	476	1.6e-139	SMART

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
  (Using ENSMUST00000103010)
• Meta Mutation Damage Score: 0.2044
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:30 PM by Anne Murray
• Record Created: 2019-01-22 12:36 PM by Bruce Beutler
• Record Posted: 2019-02-08
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Jin Huk Choi, Xue Zhong, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_001111096, NM_10747; MGI:96892

Alleles Listed at MGI

All mutations/alleles(17) : Chemically induced (ENU)(7) Targeted(9) Transgenic(1)

Phenotypic Description

Figure 1. Water mice exhibit diminished T-dependent IgG responses to ovalbumin administered with aluminum hydroxide . IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The water phenotype was identified among G3 mice of the pedigree R2421, some of which showed a diminished T-dependent antibody response to ovalbumin administered with aluminum hydroxide (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced T-dependent antibody response after OVA-alum stimulation using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 85 mutations (X-axis) identified in the G1 male of pedigree R2421. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 85 mutations. The diminished T-dependent antibody response phenotype was linked by continuous variable mapping to mutations in three genes: Lyn (chromosome 4), Rbm12b2 (chromosome 4), and Syt9 (chromosome 7). The mutation in Lyn was presumed causative as the immune phenotype of water mimics that of other mutant Lyn alleles (see MGI). The mutation in Lyn is a C to T transition at base pair 3,748,787 (v38) on chromosome 4, or base pair 70,667 in the GenBank genomic region NC_000070 encoding Lyn. Linkage was found with a recessive model of inheritance, wherein one variant homozygote departed phenotypically from five homozygous reference mice and five heterozygous mice with a P value of 2.644 x 10^-5 (Figure 2).

The mutation corresponds to residue 1,013 in the mRNA sequence NM_001111096 within exon 8 of 13 total exons.

997 GTGAAAAAGCTTGGCGCAGGGCAGTTTGGGGAA 250 -V--K--K--L--G--A--G--Q--F--G--E-

The mutated nucleotide is indicated in red. The mutation results in an alanine to valine substitution at position 255 (A255V) in the LYN protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.930).

Protein Prediction

Figure 9. Domain structure of Lyn^p56. Please see the text for details about the domains. The water mutation results in an alanine to valine substitution at position 255. This image is interactive. Other mutations found in the protein are noted in red. Click on each mutation for more information.

Lyn is a member of the Src family of tyrosine kinases (SFKs) which also includes Src, Yes, Fgr, Fyn, Lck (see the record for iconoclast), Hck, Blk, and Yrk. The members of the SFKs share highly conserved domains including a Src-homology 3 (SH3) domain (amino acids 66-122 in Lyn), an SH2 domain (amino acids 127-217), a tyrosine kinase domain (amino acids 247-497), and a C-terminal regulatory region [Figure 6; reviewed in (1-3)]. A ‘unique’ domain of 50-70 amino acids between the N-terminus and the SH3 domain varies among the members of the SFKs (3). The function of the unique domain in Lyn is unknown; in Lck it mediates protein-protein interactions between Lck and the cytoplasmic tails of the T-cell coreceptors CD4 and CD8 (4;5).

The water mutation results in an alanine to valine substitution at position 255 (A255V) within the kinase domain.
 

Please see the record Lemon for information about Lyn.

Putative Mechanism

Lyn can act as both a positive and negative signaling molecule in several cell types including hematopoietic progenitors, mature myeloid cells (neutrophils, macrophages, monocytes, eosinophils, and dendritic cells), platelets, erythrocytes, and osteoclasts. As a result, Lyn regulates several cellular functions including proliferation, degranulation, cytokine production, adhesion, activation, migration, and survival. Following BCR ligation, Lyn phosphorylates the immunoreceptor tyrosine-based activation motifs (ITAMs) of the Igα/Igβ BCR subunits (6-8). These signals allow the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), NF-κB (see the records for Finlay and xander) and AP-1, which subsequently regulate biological responses including cell proliferation, differentiation, and apoptosis as well as the secretion of antigen-specific antibodies [reviewed in (9)]. Lyn has a non-redundant role in negative regulation of BCR signaling (6). Lyn phosphorylates the ITIMs of the BCR associated co-receptors CD22 (see the record for well), Fc receptor gamma IIb (FcγRIIb), and paired immunoglobulin-like receptor-B (PIR-B) (10-15).

Lyn^-/- mice exhibit progressive splenomegaly and enlargement of lymph nodes, reduced numbers of mature follicular B cells, absence of marginal zone B cells, produce large quantities of anti-nuclear antibodies, and develop glomerulonephritis as early as 5 months of age (13;16-18). B cells from Lyn^-/- mice are both hyperresponsive to BCR ligation and resistant to the inhibitory signals from FcγRIIb and CD22 (10-13). Peritoneal IgM⁺ B220⁺ B cell numbers were significantly lower in Lyn^-/- mice at 2 months of age compared to wild-type mice and the size of the Peyer’s patches were reduced (17;18). As a result, CD5⁻ B220^high conventional B cells and B1 cells were also reduced (18).  Although they exhibit reduced T-dependent antibody responses, the water mice did not exhibit reduced frequencies of peripheral B cell numbers, indicating that some Lyn function may persist in the water mice.

Primers

PCR Primer
water_pcr_F: GGCAGCAAGCTTTCTTACCTAG
water_pcr_R: CCACATCTGATGCAGCACTG

Sequencing Primer
water_seq_F: TGGAGAAGGCATGCATCA
water_seq_R: TGCAGCACTGAGCAAGCATC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 400 nucleotides is amplified (chromosome 4, + strand):

1   ggcagcaagc tttcttacct agtgaggcat ctctgcagcc cagcatgcgt tccttaatat
61  ttgttcttcc tttcacctta gagcagtctg atggtctatg cagaagactg gagaaggcat
121 gcatcagtcc caaacctcag aagccatggg ataaagatgc ctgggagatc ccccgggagt
181 ccattaagtt ggtgaaaaag cttggcgcag ggcagtttgg ggaagtctgg atgggtgagt
241 gttcaacagt gtcccactct ggaggggatg ctaaagggtt ctagcctctg ccaaccactg
301 aaccaggccc tgggccactc aggagcataa tttcttgctt tcctgccttg agccaaactc
361 tgtctgcttt gatgcttgct cagtgctgca tcagatgtgg 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Kurosaki, T., and Hikida, M. (2009) Tyrosine Kinases and their Substrates in B Lymphocytes. Immunol Rev. 228, 132-148.

  2. Schwartzberg, P. L. (1998) The Many Faces of Src: Multiple Functions of a Prototypical Tyrosine Kinase. Oncogene. 17, 1463-1468.

  3. Boggon, T. J., and Eck, M. J. (2004) Structure and Regulation of Src Family Kinases. Oncogene. 23, 7918-7927.

  4. Rudd, C. E., Trevillyan, J. M., Dasgupta, J. D., Wong, L. L., and Schlossman, S. F. (1988) The CD4 Receptor is Complexed in Detergent Lysates to a Protein-Tyrosine Kinase (pp58) from Human T Lymphocytes. Proc Natl Acad Sci U S A. 85, 5190-5194.

  5. Veillette, A., Bookman, M. A., Horak, E. M., and Bolen, J. B. (1988) The CD4 and CD8 T Cell Surface Antigens are Associated with the Internal Membrane Tyrosine-Protein Kinase p56lck. Cell. 55, 301-308.

  6. Avila, M., Martinez-Juarez, A., Ibarra-Sanchez, A., and Gonzalez-Espinosa, C. (2012) Lyn Kinase Controls TLR4-Dependent IKK and MAPK Activation Modulating the Activity of TRAF-6/TAK-1 Protein Complex in Mast Cells. Innate Immun. 18, 648-660.

  7. Verhagen, A. M., Wallace, M. E., Goradia, A., Jones, S. A., Croom, H. A., Metcalf, D., Collinge, J. E., Maxwell, M. J., Hibbs, M. L., Alexander, W. S., Hilton, D. J., Kile, B. T., and Starr, R. (2009) A Kinase-Dead Allele of Lyn Attenuates Autoimmune Disease Normally Associated with Lyn Deficiency. J Immunol. 182, 2020-2029.

  8. Yamamoto, T., Yamanashi, Y., and Toyoshima, K. (1993) Association of Src-Family Kinase Lyn with B-Cell Antigen Receptor. Immunol Rev. 132, 187-206.

  9. Guo, B., Su, T. T., and Rawlings, D. J. (2004) Protein Kinase C Family Functions in B-Cell Activation. Curr Opin Immunol. 16, 367-373.

  10. Nishizumi, H., Horikawa, K., Mlinaric-Rascan, I., and Yamamoto, T. (1998) A Double-Edged Kinase Lyn: A Positive and Negative Regulator for Antigen Receptor-Mediated Signals. J Exp Med. 187, 1343-1348.

  11. Chan, V. W., Lowell, C. A., and DeFranco, A. L. (1998) Defective Negative Regulation of Antigen Receptor Signaling in Lyn-Deficient B Lymphocytes. Curr Biol. 8, 545-553.

  12. Smith, K. G., Tarlinton, D. M., Doody, G. M., Hibbs, M. L., and Fearon, D. T. (1998) Inhibition of the B Cell by CD22: A Requirement for Lyn. J Exp Med. 187, 807-811.

  13. Chan, V. W., Meng, F., Soriano, P., DeFranco, A. L., and Lowell, C. A. (1997) Characterization of the B Lymphocyte Populations in Lyn-Deficient Mice and the Role of Lyn in Signal Initiation and Down-Regulation. Immunity. 7, 69-81.

  14. Maeda, A., Kurosaki, M., Ono, M., Takai, T., and Kurosaki, T. (1998) Requirement of SH2-Containing Protein Tyrosine Phosphatases SHP-1 and SHP-2 for Paired Immunoglobulin-Like Receptor B (PIR-B)-Mediated Inhibitory Signal. J Exp Med. 187, 1355-1360.

  15. Ho, L. H., Uehara, T., Chen, C. C., Kubagawa, H., and Cooper, M. D. (1999) Constitutive Tyrosine Phosphorylation of the Inhibitory Paired Ig-Like Receptor PIR-B. Proc Natl Acad Sci U S A. 96, 15086-15090.

  16. Hibbs, M. L., Tarlinton, D. M., Armes, J., Grail, D., Hodgson, G., Maglitto, R., Stacker, S. A., and Dunn, A. R. (1995) Multiple Defects in the Immune System of Lyn-Deficient Mice, Culminating in Autoimmune Disease. Cell. 83, 301-311.

  17. Nishizumi, H., Taniuchi, I., Yamanashi, Y., Kitamura, D., Ilic, D., Mori, S., Watanabe, T., and Yamamoto, T. (1995) Impaired Proliferation of Peripheral B Cells and Indication of Autoimmune Disease in Lyn-Deficient Mice. Immunity. 3, 549-560.

  18. Hasegawa, M., Fujimoto, M., Poe, J. C., Steeber, D. A., Lowell, C. A., and Tedder, T. F. (2001) A CD19-Dependent Signaling Pathway Regulates Autoimmunity in Lyn-Deficient Mice. J Immunol. 167, 2469-2478.