Mutagenetix > Incidental Mutation

Incidental Mutation 'R7029:Lyn'

546172

Institutional Source

Beutler Lab

Gene Symbol

Lyn

Ensembl Gene

ENSMUSG00000042228

Gene Name

LYN proto-oncogene, Src family tyrosine kinase

Synonyms

Hck-2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7029 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

3678115-3813122 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 3782996 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 410 (T410A)

Ref Sequence

ENSEMBL: ENSMUSP00000038838 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041377] [ENSMUST00000103010]

AlphaFold

P25911

PDB Structure

Lyn Tyrosine Kinase Domain, apo form [X-RAY DIFFRACTION]
Lyn Tyrosine Kinase Domain-AMP-PNP complex [X-RAY DIFFRACTION]
Lyn Tyrosine Kinase Domain-PP2 complex [X-RAY DIFFRACTION]
Lyn Tyrosine Kinase Domain-Dasatinib complex [X-RAY DIFFRACTION]
Structure of unliganded Lyn SH2 domain [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000041377
AA Change: T410A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000038838
Gene: ENSMUSG00000042228
AA Change: T410A

Domain	Start	End	E-Value	Type
SH3	66	122	9.24e-21	SMART
SH2	127	217	5.38e-33	SMART
TyrKc	247	497	3.25e-137	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000103010
AA Change: T389A

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000100075
Gene: ENSMUSG00000042228
AA Change: T389A

Domain	Start	End	E-Value	Type
SH3	45	101	5.8e-23	SMART
SH2	106	196	3.3e-35	SMART
TyrKc	226	476	1.6e-139	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine protein kinase, which maybe involved in the regulation of mast cell degranulation, and erythroid differentiation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit splenomegaly, reduced numbers of peripheral B cells, impaired immune responses, IgM hyperglobulinemia, autoimmunity with glomerulonephritis, and monocyte/macrophage tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	T	C	6: 146,952,343	Q271R	probably benign	Het
Abhd4	T	A	14: 54,262,707	W63R	probably damaging	Het
Adcy5	A	G	16: 35,299,648	M1176V	probably null	Het
Bach1	G	A	16: 87,719,291	R240Q	probably benign	Het
Brox	G	A	1: 183,284,186	P206L	possibly damaging	Het
Def6	A	G	17: 28,225,969	K447R	probably benign	Het
Dna2	T	C	10: 62,963,994	S726P	probably damaging	Het
Ell	G	A	8: 70,579,229	V15I	probably damaging	Het
Epha3	T	A	16: 63,773,335	D130V	probably benign	Het
Fam189a1	T	A	7: 64,759,327	T440S	probably benign	Het
Gm16486	G	T	8: 70,708,862	V235L	possibly damaging	Het
Gys1	A	G	7: 45,439,584	T200A	possibly damaging	Het
Habp4	A	T	13: 64,162,125	H47L	probably benign	Het
Kcnj10	C	A	1: 172,368,996	R26S	probably benign	Het
Klhl1	T	A	14: 96,518,196	D41V	probably benign	Het
Mga	A	G	2: 119,923,550	T847A	probably damaging	Het
Mrgpra3	G	T	7: 47,589,542	T212N	probably benign	Het
Myh4	T	C	11: 67,246,425	F491L	probably benign	Het
Neurl4	T	A	11: 69,910,736	I1206N	probably damaging	Het
Nov	A	G	15: 54,747,775	D102G	possibly damaging	Het
Pcdhb15	T	A	18: 37,475,568	W618R	possibly damaging	Het
Pomc	A	G	12: 3,960,146	H129R	probably damaging	Het
Ppm1l	C	A	3: 69,553,066	H325Q	probably benign	Het
Psme4	A	G	11: 30,772,474		probably benign	Het
Reep2	A	G	18: 34,845,289	I74V	probably null	Het
Robo2	T	G	16: 73,948,337	E850A	probably damaging	Het
Scrn2	T	A	11: 97,030,436		probably benign	Het
Sfpq	G	A	4: 127,029,882	R673K	probably benign	Het
Sh2d3c	T	C	2: 32,754,569	*703R	probably null	Het
Spp1	A	G	5: 104,439,301	M85V	probably benign	Het
Srebf1	T	C	11: 60,206,984	E98G	probably damaging	Het
Srrm4	T	A	5: 116,444,792		probably benign	Het
Ticam1	A	T	17: 56,271,154	S314T	possibly damaging	Het
Tie1	T	C	4: 118,484,626	I209V	possibly damaging	Het
Vapa	G	A	17: 65,582,591	R194*	probably null	Het
Vcan	C	T	13: 89,690,241	D2395N	probably damaging	Het
Whamm	A	G	7: 81,591,826	H295R	probably benign	Het
Zdhhc14	A	G	17: 5,647,911	Y85C	probably damaging	Het
Zfp35	T	A	18: 24,003,526	F309Y	probably damaging	Het
Zfp423	C	A	8: 87,688,066	C1187F	probably damaging	Het
Zfp874b	T	C	13: 67,474,273	Y302C	probably damaging	Het

Other mutations in Lyn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01752:Lyn	APN	4	3743286	missense	probably benign
IGL02744:Lyn	APN	4	3738808	missense	probably benign	0.00
IGL02860:Lyn	APN	4	3745594	missense	possibly damaging	0.77
IGL03328:Lyn	APN	4	3745327	missense	probably benign	0.01
IGL03370:Lyn	APN	4	3780931	missense	possibly damaging	0.81
bibb	UTSW	4	3783055	missense	probably damaging	1.00
butterhead	UTSW	4	3748765	missense	probably benign	0.11
Cress	UTSW	4	3789908	nonsense	probably null
Friede	UTSW	4	3789834	nonsense	probably null
Kohlrabi	UTSW	4	3783089	missense	possibly damaging	0.74
lechuga	UTSW	4	3783050	missense	probably damaging	1.00
Lemon	UTSW	4	3746768	missense	probably damaging	1.00
Pacific	UTSW	4	3745330	missense	probably damaging	1.00
water	UTSW	4	3748787	missense	possibly damaging	0.93
R0079:Lyn	UTSW	4	3746768	missense	probably damaging	1.00
R0089:Lyn	UTSW	4	3748768	missense	probably benign	0.23
R0582:Lyn	UTSW	4	3743296	missense	probably damaging	1.00
R0747:Lyn	UTSW	4	3745638	splice site	probably benign
R1460:Lyn	UTSW	4	3789908	nonsense	probably null
R1615:Lyn	UTSW	4	3748765	missense	probably benign	0.11
R1654:Lyn	UTSW	4	3789912	missense	probably damaging	0.99
R1703:Lyn	UTSW	4	3738867	splice site	probably null
R2301:Lyn	UTSW	4	3780959	missense	probably damaging	1.00
R2421:Lyn	UTSW	4	3748787	missense	possibly damaging	0.93
R2512:Lyn	UTSW	4	3745542	missense	probably benign	0.01
R3418:Lyn	UTSW	4	3746833	missense	probably damaging	0.97
R3419:Lyn	UTSW	4	3746833	missense	probably damaging	0.97
R3701:Lyn	UTSW	4	3742455	missense	probably benign
R3702:Lyn	UTSW	4	3742455	missense	probably benign
R3736:Lyn	UTSW	4	3745330	missense	probably damaging	1.00
R4350:Lyn	UTSW	4	3789796	missense	probably damaging	0.99
R4351:Lyn	UTSW	4	3789796	missense	probably damaging	0.99
R4352:Lyn	UTSW	4	3789796	missense	probably damaging	0.99
R4649:Lyn	UTSW	4	3738850	missense	probably benign
R5738:Lyn	UTSW	4	3782987	missense	probably damaging	1.00
R5875:Lyn	UTSW	4	3745631	splice site	probably null
R6375:Lyn	UTSW	4	3745527	missense	probably damaging	1.00
R7621:Lyn	UTSW	4	3789834	nonsense	probably null
R7726:Lyn	UTSW	4	3756428	nonsense	probably null
R7940:Lyn	UTSW	4	3783089	missense	possibly damaging	0.74
R8169:Lyn	UTSW	4	3783050	missense	probably damaging	1.00
R8341:Lyn	UTSW	4	3743304	critical splice donor site	probably null
R8782:Lyn	UTSW	4	3783055	missense	probably damaging	1.00
R9056:Lyn	UTSW	4	3780925	missense	possibly damaging	0.89
R9353:Lyn	UTSW	4	3746804	missense	possibly damaging	0.71
R9567:Lyn	UTSW	4	3746757	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGTTCCAGAAGAAACTGCTTC -3'
(R):5'- AGACAGAGCTATTGTCTCTGGG -3'

Sequencing Primer
(F):5'- CTGCTTCTAAGGAGGGGAGGAC -3'
(R):5'- CTGGGGTGCTTGTTCTCCC -3'

Posted On

2019-05-13