Mutagenetix > Incidental Mutation

Incidental Mutation 'R5738:Lyn'

444613

Institutional Source

Beutler Lab

Gene Symbol

Lyn

Ensembl Gene

ENSMUSG00000042228

Gene Name

LYN proto-oncogene, Src family tyrosine kinase

Synonyms

Hck-2

MMRRC Submission

043350-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5738 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3678115-3813122 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 3782987 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 386 (I386F)

Ref Sequence

ENSEMBL: ENSMUSP00000100075 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041377] [ENSMUST00000103010]

AlphaFold

P25911

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041377
AA Change: I407F

PolyPhen 2 Score 0.744 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000038838
Gene: ENSMUSG00000042228
AA Change: I407F

Domain	Start	End	E-Value	Type
SH3	66	122	9.24e-21	SMART
SH2	127	217	5.38e-33	SMART
TyrKc	247	497	3.25e-137	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000103010
AA Change: I386F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000100075
Gene: ENSMUSG00000042228
AA Change: I386F

Domain	Start	End	E-Value	Type
SH3	45	101	5.8e-23	SMART
SH2	106	196	3.3e-35	SMART
TyrKc	226	476	1.6e-139	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137943

Meta Mutation Damage Score

0.8588

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine protein kinase, which maybe involved in the regulation of mast cell degranulation, and erythroid differentiation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit splenomegaly, reduced numbers of peripheral B cells, impaired immune responses, IgM hyperglobulinemia, autoimmunity with glomerulonephritis, and monocyte/macrophage tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	T	11: 9,621,917	D4826V	probably damaging	Het
Acoxl	G	A	2: 127,877,766	C149Y	probably benign	Het
Adamts3	G	T	5: 89,708,668	H349N	probably damaging	Het
Ap2b1	A	G	11: 83,336,430		probably null	Het
Ap3m2	T	C	8: 22,803,861	S58G	possibly damaging	Het
Bhmt2	A	T	13: 93,663,290	W213R	probably benign	Het
Cacna1h	T	G	17: 25,387,049	D1092A	probably damaging	Het
Cbfb	A	C	8: 105,202,561	Q170P	probably damaging	Het
Ccdc73	A	C	2: 104,930,986	K110N	possibly damaging	Het
Cep350	C	A	1: 155,866,078	R2149L	probably damaging	Het
Cog2	A	G	8: 124,546,038	T525A	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Fbxl5	A	G	5: 43,762,828	I251T	probably benign	Het
Fscn3	A	G	6: 28,430,031	K67E	possibly damaging	Het
Glmp	T	A	3: 88,326,138	N133K	probably benign	Het
Gpr179	T	C	11: 97,351,406	N204S	probably damaging	Het
Gtf2ird1	C	T	5: 134,383,818	R613Q	probably damaging	Het
Hepacam	A	G	9: 37,383,425	D285G	possibly damaging	Het
Hipk4	G	A	7: 27,528,416	V196M	probably damaging	Het
Hlx	A	T	1: 184,731,557		probably null	Het
Igf2r	A	T	17: 12,717,367	D597E	probably benign	Het
Ighm	T	C	12: 113,421,495	T282A	unknown	Het
Igsf9b	T	C	9: 27,328,530	C624R	probably damaging	Het
Ksr2	T	C	5: 117,748,799	V800A	probably damaging	Het
Melk	A	G	4: 44,310,333	D102G	probably damaging	Het
Mettl1	G	T	10: 127,041,994	E4*	probably null	Het
Mybl2	C	T	2: 163,068,283	Q210*	probably null	Het
Naga	C	T	15: 82,334,853	W231*	probably null	Het
Olfr131	T	C	17: 38,082,456	Y174C	probably damaging	Het
Olfr730	C	T	14: 50,186,648	V190I	probably benign	Het
Olfr828	T	C	9: 18,815,829	N155S	possibly damaging	Het
Otud4	T	C	8: 79,673,461	S935P	probably benign	Het
P2rx7	C	T	5: 122,652,789	T63I	probably damaging	Het
Pga5	A	T	19: 10,669,660	N260K	probably benign	Het
Phka2	ACC	AC	X: 160,559,866		probably null	Het
Plch1	T	A	3: 63,773,655	R184W	probably damaging	Het
Ppm1b	T	C	17: 84,993,946	F85L	probably benign	Het
Prtg	T	A	9: 72,912,006	F1094I	probably benign	Het
Ralgds	G	A	2: 28,542,526		probably benign	Het
Rgs17	A	C	10: 5,833,140	V149G	probably damaging	Het
Rnf168	A	G	16: 32,282,374	E124G	probably damaging	Het
Sav1	T	C	12: 69,976,043	E245G	possibly damaging	Het
Slc25a19	T	C	11: 115,624,234	I33V	probably benign	Het
Sptbn1	T	C	11: 30,145,941	I318V	probably damaging	Het
Tas2r136	A	G	6: 132,777,744	L140P	probably damaging	Het
Tbc1d9	A	G	8: 83,271,026	I1071V	probably benign	Het
Tecta	G	T	9: 42,373,178	N870K	possibly damaging	Het
Tmem230	G	A	2: 132,244,128	P38L	possibly damaging	Het
Trpa1	G	T	1: 14,875,950	H986N	probably damaging	Het
Wdr41	A	T	13: 94,978,488	I24L	possibly damaging	Het

Other mutations in Lyn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01752:Lyn	APN	4	3743286	missense	probably benign
IGL02744:Lyn	APN	4	3738808	missense	probably benign	0.00
IGL02860:Lyn	APN	4	3745594	missense	possibly damaging	0.77
IGL03328:Lyn	APN	4	3745327	missense	probably benign	0.01
IGL03370:Lyn	APN	4	3780931	missense	possibly damaging	0.81
bibb	UTSW	4	3783055	missense	probably damaging	1.00
butterhead	UTSW	4	3748765	missense	probably benign	0.11
Cress	UTSW	4	3789908	nonsense	probably null
Friede	UTSW	4	3789834	nonsense	probably null
Kohlrabi	UTSW	4	3783089	missense	possibly damaging	0.74
lechuga	UTSW	4	3783050	missense	probably damaging	1.00
Lemon	UTSW	4	3746768	missense	probably damaging	1.00
Pacific	UTSW	4	3745330	missense	probably damaging	1.00
water	UTSW	4	3748787	missense	possibly damaging	0.93
R0079:Lyn	UTSW	4	3746768	missense	probably damaging	1.00
R0089:Lyn	UTSW	4	3748768	missense	probably benign	0.23
R0582:Lyn	UTSW	4	3743296	missense	probably damaging	1.00
R0747:Lyn	UTSW	4	3745638	splice site	probably benign
R1460:Lyn	UTSW	4	3789908	nonsense	probably null
R1615:Lyn	UTSW	4	3748765	missense	probably benign	0.11
R1654:Lyn	UTSW	4	3789912	missense	probably damaging	0.99
R1703:Lyn	UTSW	4	3738867	splice site	probably null
R2301:Lyn	UTSW	4	3780959	missense	probably damaging	1.00
R2421:Lyn	UTSW	4	3748787	missense	possibly damaging	0.93
R2512:Lyn	UTSW	4	3745542	missense	probably benign	0.01
R3418:Lyn	UTSW	4	3746833	missense	probably damaging	0.97
R3419:Lyn	UTSW	4	3746833	missense	probably damaging	0.97
R3701:Lyn	UTSW	4	3742455	missense	probably benign
R3702:Lyn	UTSW	4	3742455	missense	probably benign
R3736:Lyn	UTSW	4	3745330	missense	probably damaging	1.00
R4350:Lyn	UTSW	4	3789796	missense	probably damaging	0.99
R4351:Lyn	UTSW	4	3789796	missense	probably damaging	0.99
R4352:Lyn	UTSW	4	3789796	missense	probably damaging	0.99
R4649:Lyn	UTSW	4	3738850	missense	probably benign
R5875:Lyn	UTSW	4	3745631	splice site	probably null
R6375:Lyn	UTSW	4	3745527	missense	probably damaging	1.00
R7029:Lyn	UTSW	4	3782996	missense	probably damaging	0.98
R7621:Lyn	UTSW	4	3789834	nonsense	probably null
R7726:Lyn	UTSW	4	3756428	nonsense	probably null
R7940:Lyn	UTSW	4	3783089	missense	possibly damaging	0.74
R8169:Lyn	UTSW	4	3783050	missense	probably damaging	1.00
R8341:Lyn	UTSW	4	3743304	critical splice donor site	probably null
R8782:Lyn	UTSW	4	3783055	missense	probably damaging	1.00
R9056:Lyn	UTSW	4	3780925	missense	possibly damaging	0.89
R9353:Lyn	UTSW	4	3746804	missense	possibly damaging	0.71
R9567:Lyn	UTSW	4	3746757	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGTTCCAGAAGAAACTGCTTC -3'
(R):5'- CAGAGCTATTGTCTCTGGGG -3'

Sequencing Primer
(F):5'- CTGCTTCTAAGGAGGGGAGGAC -3'
(R):5'- CTGGGGTGCTTGTTCTCCC -3'

Posted On

2016-11-21