Incidental Mutation 'R1571:Wdcp'
ID186221
Institutional Source Beutler Lab
Gene Symbol Wdcp
Ensembl Gene ENSMUSG00000051721
Gene NameWD repeat and coiled coil containing
SynonymsBC068281
MMRRC Submission 039610-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.315) question?
Stock #R1571 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location4843303-4860043 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 4851924 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 593 (Y593*)
Ref Sequence ENSEMBL: ENSMUSP00000152571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053034] [ENSMUST00000085793] [ENSMUST00000220170] [ENSMUST00000220215] [ENSMUST00000223551]
Predicted Effect probably null
Transcript: ENSMUST00000053034
AA Change: Y593*
SMART Domains Protein: ENSMUSP00000054102
Gene: ENSMUSG00000051721
AA Change: Y593*

DomainStartEndE-ValueType
Pfam:DUF4613 2 610 1.9e-260 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000085793
AA Change: Y593*
SMART Domains Protein: ENSMUSP00000082948
Gene: ENSMUSG00000051721
AA Change: Y593*

DomainStartEndE-ValueType
Pfam:DUF4613 2 643 2.4e-280 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219069
Predicted Effect probably benign
Transcript: ENSMUST00000220170
Predicted Effect probably null
Transcript: ENSMUST00000220215
AA Change: Y593*
Predicted Effect probably null
Transcript: ENSMUST00000223551
AA Change: Y593*
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610524H06Rik A G 5: 114,823,311 probably null Het
Abcd3 T C 3: 121,792,842 I70V possibly damaging Het
Acad10 T C 5: 121,621,348 Y1024C probably damaging Het
Atp2b3 T G X: 73,545,106 V701G probably damaging Het
Cbfa2t2 T A 2: 154,500,427 M21K probably damaging Het
Cdc25a C T 9: 109,881,546 T106I possibly damaging Het
Cdhr5 T C 7: 141,272,170 T190A probably damaging Het
Chl1 A G 6: 103,708,484 T829A probably benign Het
Clcn6 T C 4: 148,012,769 T614A possibly damaging Het
Cntln A T 4: 84,947,586 R160* probably null Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dock3 C A 9: 106,937,959 M1236I possibly damaging Het
Eif4g3 T A 4: 138,120,408 H213Q probably damaging Het
Eya1 T A 1: 14,208,917 H372L probably damaging Het
Fam13b A G 18: 34,497,432 V91A possibly damaging Het
Gm5724 A T 6: 141,754,409 C132* probably null Het
Hat1 T A 2: 71,434,175 I319K probably benign Het
Kcnf1 T C 12: 17,175,852 N123D probably benign Het
Kcns3 C A 12: 11,091,550 G383W probably damaging Het
Kprp A T 3: 92,825,382 C120* probably null Het
Lama3 T A 18: 12,539,717 C2456S probably damaging Het
Lrp1b A T 2: 41,476,646 D539E probably damaging Het
Matn3 T C 12: 8,955,466 L292S probably damaging Het
Mbd3l1 T A 9: 18,484,651 I24N probably damaging Het
Med10 T C 13: 69,810,040 L37P probably damaging Het
Mrc1 A T 2: 14,308,733 H925L probably damaging Het
Myo15 T A 11: 60,518,464 I3219N probably damaging Het
Nom1 C T 5: 29,442,635 Q623* probably null Het
Nrm T A 17: 35,864,187 W136R probably damaging Het
Olfr1098 A C 2: 86,923,445 V29G probably benign Het
Pde7b T C 10: 20,413,090 N298S probably benign Het
Piezo2 C T 18: 63,144,919 A305T possibly damaging Het
Pimreg T C 11: 72,045,216 L175P possibly damaging Het
Pkhd1l1 A G 15: 44,526,841 D1451G probably benign Het
Ptpro A G 6: 137,378,130 S212G probably benign Het
Rhpn1 C T 15: 75,714,118 R627C possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnase4 T G 14: 51,105,040 F74V probably damaging Het
Sbno2 A G 10: 80,060,392 probably null Het
Selp T C 1: 164,126,607 Y159H probably damaging Het
Senp6 A G 9: 80,093,571 T21A probably damaging Het
Slco3a1 T C 7: 74,504,380 D148G possibly damaging Het
Smtn G A 11: 3,530,102 P373L probably benign Het
Snx20 A T 8: 88,629,969 L73Q probably damaging Het
Sobp A G 10: 43,157,946 V128A possibly damaging Het
Tcerg1 A G 18: 42,524,292 T280A unknown Het
Tgfbrap1 A G 1: 43,049,813 V810A probably benign Het
Thbs1 C A 2: 118,119,197 D589E probably damaging Het
Tjp2 A G 19: 24,100,875 Y885H probably damaging Het
Tmem109 A G 19: 10,872,629 S100P probably damaging Het
Trim36 T C 18: 46,172,495 K462E probably benign Het
Vmn1r226 A T 17: 20,688,276 I257F probably damaging Het
Vmn2r92 A G 17: 18,152,090 Y54C probably damaging Het
Wdr59 T C 8: 111,451,050 S907G probably damaging Het
Other mutations in Wdcp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Wdcp APN 12 4855303 missense probably damaging 1.00
IGL00774:Wdcp APN 12 4855303 missense probably damaging 1.00
IGL02327:Wdcp APN 12 4851115 missense possibly damaging 0.95
IGL02725:Wdcp APN 12 4851206 missense probably damaging 1.00
IGL03377:Wdcp APN 12 4850691 nonsense probably null
IGL03381:Wdcp APN 12 4851926 missense probably damaging 1.00
R0152:Wdcp UTSW 12 4851583 missense probably benign 0.06
R0317:Wdcp UTSW 12 4851583 missense probably benign 0.06
R1077:Wdcp UTSW 12 4850685 missense probably damaging 1.00
R1136:Wdcp UTSW 12 4851655 missense possibly damaging 0.78
R1653:Wdcp UTSW 12 4851815 missense probably damaging 1.00
R1848:Wdcp UTSW 12 4850245 missense possibly damaging 0.86
R4091:Wdcp UTSW 12 4855279 missense probably null 0.00
R5126:Wdcp UTSW 12 4850617 missense probably damaging 0.98
R6148:Wdcp UTSW 12 4850621 missense possibly damaging 0.74
R6529:Wdcp UTSW 12 4851143 missense probably damaging 1.00
R6800:Wdcp UTSW 12 4851358 missense probably damaging 1.00
U24488:Wdcp UTSW 12 4850405 missense probably damaging 1.00
X0026:Wdcp UTSW 12 4851077 nonsense probably null
Z1088:Wdcp UTSW 12 4850825 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGCCCAGCATTGCCTAGACC -3'
(R):5'- TGTGCAAAGGAATGCCAAACTGCTC -3'

Sequencing Primer
(F):5'- ATTGCCTAGACCCAGCAGG -3'
(R):5'- ACTGCTCTAACAGGTCACTGG -3'
Posted On2014-05-09