Mutagenetix > Incidental Mutation

Incidental Mutation 'R1995:Kirrel1'

225663

Institutional Source

Beutler Lab

Gene Symbol

Kirrel1

Ensembl Gene

ENSMUSG00000041734

Gene Name

kirre like nephrin family adhesion molecule 1

Synonyms

6720469N11Rik, Neph1, Kirrel1, Kirrel

MMRRC Submission

040005-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1995 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86985900-87082054 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 87003093 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Aspartic acid at position 100 (A100D)

Ref Sequence

ENSEMBL: ENSMUSP00000125525 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041732] [ENSMUST00000107618] [ENSMUST00000159976]

AlphaFold

Q80W68

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041732
AA Change: A100D

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000043756
Gene: ENSMUSG00000041734
AA Change: A100D

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107618
AA Change: A100D

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000103243
Gene: ENSMUSG00000041734
AA Change: A100D

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC
low complexity region	694	712	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000159976
AA Change: A100D

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000125525
Gene: ENSMUSG00000041734
AA Change: A100D

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC
low complexity region	694	712	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NEPH1 is a member of the nephrin-like protein family, which includes NEPH2 (MIM 607761) and NEPH3 (MIM 607762). The cytoplasmic domains of these proteins interact with the C terminus of podocin (NPHS2; MIM 604766), and the genes are expressed in kidney podocytes, cells involved in ensuring size- and charge-selective ultrafiltration (Sellin et al., 2003 [PubMed 12424224]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit postnatal lethality and are small and sickly. Glomerular and tubular defects in the kidney result in severe proteinuria. [provided by MGI curators]

Allele List at MGI

All alleles(121) : Targeted, other(2) Gene trapped(119)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agtpbp1	T	G	13: 59,678,872 (GRCm39)	K145N	probably damaging	Het
AY358078	T	A	14: 52,063,519 (GRCm39)	D388E	probably damaging	Het
Btbd9	A	G	17: 30,493,904 (GRCm39)	Y496H	possibly damaging	Het
Catsperb	T	A	12: 101,569,026 (GRCm39)	N899K	possibly damaging	Het
Cenpl	T	C	1: 160,905,994 (GRCm39)	S123P	probably damaging	Het
Cep120	G	A	18: 53,873,208 (GRCm39)	T41I	probably damaging	Het
Cep295	C	T	9: 15,252,179 (GRCm39)	E397K	probably damaging	Het
Cnbd1	G	A	4: 19,055,112 (GRCm39)	P105S	possibly damaging	Het
Col6a1	T	C	10: 76,557,790 (GRCm39)	N149D	probably damaging	Het
Ctnna3	T	A	10: 63,656,143 (GRCm39)	V241D	probably damaging	Het
Dcbld2	A	C	16: 58,276,695 (GRCm39)	E495D	probably benign	Het
Dmp1	T	G	5: 104,357,779 (GRCm39)	S40A	possibly damaging	Het
Dpysl4	A	G	7: 138,676,686 (GRCm39)	I379V	probably benign	Het
Eral1	C	T	11: 77,965,315 (GRCm39)	G367S	probably benign	Het
Fah	C	T	7: 84,251,389 (GRCm39)	R31Q	probably damaging	Het
Fbn1	T	A	2: 125,192,293 (GRCm39)		probably null	Het
Fbxo40	T	C	16: 36,790,231 (GRCm39)	D293G	probably damaging	Het
Gemin6	A	C	17: 80,535,414 (GRCm39)	T125P	probably damaging	Het
Gpbar1	G	A	1: 74,318,603 (GRCm39)	G282D	possibly damaging	Het
Gria2	G	A	3: 80,709,664 (GRCm39)	L10F	probably benign	Het
Gucy1b1	A	G	3: 81,942,160 (GRCm39)	I533T	probably damaging	Het
H2-M9	A	T	17: 36,952,678 (GRCm39)	Y123N	probably damaging	Het
Hipk2	C	A	6: 38,692,909 (GRCm39)	D868Y	probably damaging	Het
Itprid1	T	C	6: 55,945,694 (GRCm39)	I805T	probably benign	Het
Jarid2	T	C	13: 45,027,917 (GRCm39)	L123P	probably damaging	Het
Kcnb2	C	A	1: 15,779,990 (GRCm39)	N287K	possibly damaging	Het
Kdm8	G	A	7: 125,051,511 (GRCm39)	G35S	probably benign	Het
Ltbp2	T	G	12: 84,855,220 (GRCm39)		probably null	Het
Mfsd12	C	A	10: 81,193,515 (GRCm39)	H28Q	probably damaging	Het
Neb	C	T	2: 52,188,744 (GRCm39)	V837M	probably damaging	Het
Nkain2	A	G	10: 32,278,347 (GRCm39)	I26T	possibly damaging	Het
Nuggc	A	G	14: 65,848,623 (GRCm39)	R175G	probably benign	Het
Or10ag57	T	G	2: 87,218,175 (GRCm39)	I42R	probably damaging	Het
Or5ac23	A	G	16: 59,149,654 (GRCm39)	S73P	probably damaging	Het
Or5d35	T	A	2: 87,856,016 (GRCm39)	S317T	probably benign	Het
Or8g52	T	C	9: 39,630,709 (GRCm39)	F62S	probably damaging	Het
Pcnt	G	A	10: 76,228,633 (GRCm39)	Q1511*	probably null	Het
Piezo2	G	T	18: 63,211,852 (GRCm39)	T1311K	probably damaging	Het
Pik3c2a	T	C	7: 115,953,241 (GRCm39)	Y1218C	probably damaging	Het
Pik3r4	T	A	9: 105,546,364 (GRCm39)	S905T	probably benign	Het
Pikfyve	T	A	1: 65,285,867 (GRCm39)	D1035E	probably damaging	Het
Pkn3	G	C	2: 29,979,989 (GRCm39)	G744A	probably damaging	Het
Pms1	A	G	1: 53,234,174 (GRCm39)	S781P	probably benign	Het
Pogz	C	T	3: 94,785,255 (GRCm39)	R793W	probably damaging	Het
Prrc2a	A	T	17: 35,376,405 (GRCm39)	V795D	probably damaging	Het
Rock1	G	A	18: 10,101,026 (GRCm39)	R630*	probably null	Het
Scd4	T	A	19: 44,322,617 (GRCm39)	I70N	possibly damaging	Het
Serpine2	A	G	1: 79,799,159 (GRCm39)	S32P	probably damaging	Het
Slc9c1	A	C	16: 45,374,618 (GRCm39)	T328P	probably damaging	Het
Spata31d1b	G	C	13: 59,864,194 (GRCm39)	L447F	probably benign	Het
Speer2	A	G	16: 69,654,965 (GRCm39)	S167P	probably benign	Het
Sphkap	G	A	1: 83,255,236 (GRCm39)	R838*	probably null	Het
Tbcel	C	A	9: 42,362,957 (GRCm39)	G29W	probably damaging	Het
Tmcc3	T	C	10: 94,414,468 (GRCm39)	S57P	possibly damaging	Het
Tmem240	T	A	4: 155,824,304 (GRCm39)	D125E	possibly damaging	Het
Ttll7	G	A	3: 146,667,510 (GRCm39)	C792Y	possibly damaging	Het
Vmn1r177	T	A	7: 23,565,112 (GRCm39)	I255F	probably damaging	Het
Zp2	T	A	7: 119,734,388 (GRCm39)	I554F	probably damaging	Het

Other mutations in Kirrel1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Kirrel1	APN	3	86,997,182 (GRCm39)	missense	probably benign	0.22
IGL01865:Kirrel1	APN	3	86,993,731 (GRCm39)	missense	probably damaging	1.00
IGL01875:Kirrel1	APN	3	87,003,037 (GRCm39)	missense	probably damaging	1.00
IGL02337:Kirrel1	APN	3	86,996,519 (GRCm39)	missense	possibly damaging	0.64
IGL02724:Kirrel1	APN	3	86,997,780 (GRCm39)	nonsense	probably null
IGL02825:Kirrel1	APN	3	86,996,595 (GRCm39)	splice site	probably benign
IGL02826:Kirrel1	APN	3	86,995,792 (GRCm39)	missense	probably damaging	1.00
IGL03102:Kirrel1	APN	3	86,990,807 (GRCm39)	missense	probably damaging	0.98
D4043:Kirrel1	UTSW	3	86,990,510 (GRCm39)	missense	probably benign	0.02
R0360:Kirrel1	UTSW	3	86,997,106 (GRCm39)	missense	probably damaging	1.00
R0364:Kirrel1	UTSW	3	86,997,106 (GRCm39)	missense	probably damaging	1.00
R0421:Kirrel1	UTSW	3	86,990,914 (GRCm39)	missense	probably damaging	0.99
R0503:Kirrel1	UTSW	3	87,005,109 (GRCm39)	missense	probably benign	0.20
R1112:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1116:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1144:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1147:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1147:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1190:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1226:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1501:Kirrel1	UTSW	3	86,997,779 (GRCm39)	missense	probably benign	0.02
R1538:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1546:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1628:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1630:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1631:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1664:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1671:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1695:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1769:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1807:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1808:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1840:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1876:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2014:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2086:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2108:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2354:Kirrel1	UTSW	3	86,995,792 (GRCm39)	missense	probably damaging	0.98
R2407:Kirrel1	UTSW	3	86,992,150 (GRCm39)	missense	probably benign	0.03
R2904:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2905:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2958:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2959:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2960:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2961:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3026:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3028:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3034:Kirrel1	UTSW	3	86,990,746 (GRCm39)	missense	possibly damaging	0.56
R3149:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3195:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3196:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3499:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3699:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3720:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3721:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3788:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3793:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3876:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3877:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3901:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3910:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3911:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3912:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3913:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3930:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3931:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4022:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4067:Kirrel1	UTSW	3	86,995,774 (GRCm39)	nonsense	probably null
R4077:Kirrel1	UTSW	3	86,992,387 (GRCm39)	critical splice donor site	probably null
R4198:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4328:Kirrel1	UTSW	3	86,992,081 (GRCm39)	intron	probably benign
R4355:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4363:Kirrel1	UTSW	3	86,997,792 (GRCm39)	nonsense	probably null
R4378:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4386:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4460:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4468:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4469:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4650:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4652:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4734:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4748:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4749:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R5304:Kirrel1	UTSW	3	86,996,902 (GRCm39)	missense	probably benign	0.02
R5534:Kirrel1	UTSW	3	86,997,825 (GRCm39)	missense	probably damaging	1.00
R5604:Kirrel1	UTSW	3	86,996,462 (GRCm39)	missense	possibly damaging	0.69
R7199:Kirrel1	UTSW	3	86,990,695 (GRCm39)	missense	probably benign	0.02
R7221:Kirrel1	UTSW	3	86,993,704 (GRCm39)	nonsense	probably null
R7284:Kirrel1	UTSW	3	86,990,694 (GRCm39)	missense	probably benign	0.02
R7332:Kirrel1	UTSW	3	86,995,705 (GRCm39)	missense	probably benign	0.14
R7369:Kirrel1	UTSW	3	87,048,391 (GRCm39)	missense	probably benign	0.20
R7371:Kirrel1	UTSW	3	86,995,729 (GRCm39)	missense	probably benign	0.44
R7508:Kirrel1	UTSW	3	86,990,746 (GRCm39)	missense	possibly damaging	0.56
R7566:Kirrel1	UTSW	3	86,995,791 (GRCm39)	missense	probably damaging	1.00
R7567:Kirrel1	UTSW	3	87,002,988 (GRCm39)	missense	probably damaging	0.99
R7621:Kirrel1	UTSW	3	86,995,528 (GRCm39)	missense	possibly damaging	0.70
R8030:Kirrel1	UTSW	3	87,005,082 (GRCm39)	missense	probably damaging	1.00
R8141:Kirrel1	UTSW	3	86,993,735 (GRCm39)	nonsense	probably null
R8261:Kirrel1	UTSW	3	86,995,309 (GRCm39)	intron	probably benign
R8477:Kirrel1	UTSW	3	86,992,138 (GRCm39)	missense	possibly damaging	0.71
R8512:Kirrel1	UTSW	3	86,995,534 (GRCm39)	missense	probably benign	0.00
R8954:Kirrel1	UTSW	3	86,997,173 (GRCm39)	missense	probably benign	0.25
R8987:Kirrel1	UTSW	3	86,992,400 (GRCm39)	missense	probably damaging	1.00
R9058:Kirrel1	UTSW	3	86,992,442 (GRCm39)	missense	probably benign	0.18
R9146:Kirrel1	UTSW	3	87,003,015 (GRCm39)	missense	probably damaging	1.00
R9311:Kirrel1	UTSW	3	87,005,123 (GRCm39)	missense	probably benign	0.29
R9527:Kirrel1	UTSW	3	86,996,912 (GRCm39)	nonsense	probably null
R9629:Kirrel1	UTSW	3	87,003,025 (GRCm39)	nonsense	probably null
Z1177:Kirrel1	UTSW	3	86,991,182 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTGGAAAATGAGAAACCCAGCTTG -3'
(R):5'- TTTCGGTCCCACAGCTATGG -3'

Sequencing Primer
(F):5'- AGCTTGGGAGTCATTACTGAGCAC -3'
(R):5'- CCACAGCTATGGAGTCTGTGTC -3'

Posted On

2014-08-25