Incidental Mutation 'R3729:Gcn1l1'
ID270874
Institutional Source Beutler Lab
Gene Symbol Gcn1l1
Ensembl Gene ENSMUSG00000041638
Gene NameGCN1 general control of amino-acid synthesis 1-like 1 (yeast)
SynonymsGCN1L, G431004K08Rik
MMRRC Submission 040719-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R3729 (G1)
Quality Score215
Status Validated
Chromosome5
Chromosomal Location115565254-115622654 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 115583394 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000069432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064454]
Predicted Effect probably benign
Transcript: ENSMUST00000064454
SMART Domains Protein: ENSMUSP00000069432
Gene: ENSMUSG00000041638

DomainStartEndE-ValueType
low complexity region 64 84 N/A INTRINSIC
low complexity region 108 117 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
Pfam:DUF3554 357 705 2e-61 PFAM
coiled coil region 806 866 N/A INTRINSIC
Blast:ARM 1028 1068 6e-11 BLAST
coiled coil region 1180 1203 N/A INTRINSIC
low complexity region 1457 1466 N/A INTRINSIC
low complexity region 1501 1510 N/A INTRINSIC
ARM 1527 1567 3.69e1 SMART
Blast:ARM 1602 1644 1e-5 BLAST
Blast:EZ_HEAT 1671 1704 1e-7 BLAST
low complexity region 1926 1934 N/A INTRINSIC
low complexity region 1956 1972 N/A INTRINSIC
ARM 2034 2070 9.27e1 SMART
low complexity region 2326 2334 N/A INTRINSIC
ARM 2416 2455 2.16e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184777
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A G 5: 114,207,348 D954G probably damaging Het
Acvr1 T C 2: 58,462,913 K345R probably null Het
Aldoart2 A G 12: 55,566,319 Y343C probably damaging Het
Arpp21 T A 9: 112,065,979 Y739F possibly damaging Het
Cachd1 C A 4: 100,974,880 Y746* probably null Het
Card14 T C 11: 119,333,932 V595A probably damaging Het
Dhx33 T C 11: 70,989,152 D344G probably benign Het
Dnah12 T A 14: 26,706,065 D171E probably benign Het
Fat3 A G 9: 16,247,041 probably benign Het
Fmnl3 A G 15: 99,321,864 F668L probably damaging Het
Frmpd4 G A X: 167,486,807 T493M probably damaging Het
Hspbp1 G T 7: 4,677,809 Q223K probably damaging Het
Ighv1-19 C A 12: 114,708,877 C40F probably damaging Het
Igkv4-90 A G 6: 68,807,681 F10L probably benign Het
Kctd5 T C 17: 24,059,238 D146G probably benign Het
Kif4-ps A G 12: 101,146,110 E166G probably damaging Het
Lemd3 T C 10: 120,928,015 D780G probably damaging Het
Manba G A 3: 135,554,850 V599I probably benign Het
Map2 A G 1: 66,412,446 E247G possibly damaging Het
Mfsd1 T C 3: 67,582,965 F50L probably benign Het
Mier2 T C 10: 79,545,042 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nol10 A T 12: 17,424,673 K622I probably benign Het
Olfr486 A T 7: 108,172,309 I145N probably benign Het
Olfr926 T C 9: 38,877,251 F25S probably damaging Het
Phtf1 A G 3: 103,985,779 M120V probably benign Het
Prrx1 A G 1: 163,261,877 L127P probably damaging Het
Rbsn T C 6: 92,191,335 M373V possibly damaging Het
Sec24b T C 3: 130,033,833 K203R possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc4a7 A T 14: 14,729,276 E47D probably damaging Het
Taf12 C A 4: 132,282,954 P78Q probably damaging Het
Tnn A G 1: 160,146,240 C186R probably damaging Het
Trim46 T A 3: 89,234,949 T721S probably benign Het
Trip4 T C 9: 65,880,942 N74D possibly damaging Het
Tssk5 C T 15: 76,372,896 R262H probably benign Het
Vegfa T C 17: 46,024,520 I105V possibly damaging Het
Vmn2r14 T C 5: 109,216,229 Y607C probably damaging Het
Wdr83 G T 8: 85,080,339 H66Q probably damaging Het
Zfp280b A G 10: 76,039,102 T272A probably benign Het
Zfp960 T A 17: 17,088,371 L449H probably damaging Het
Other mutations in Gcn1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00869:Gcn1l1 APN 5 115588143 splice site probably benign
IGL00974:Gcn1l1 APN 5 115613793 missense possibly damaging 0.88
IGL01566:Gcn1l1 APN 5 115611058 missense probably damaging 1.00
IGL01843:Gcn1l1 APN 5 115619700 missense probably damaging 1.00
IGL01885:Gcn1l1 APN 5 115576115 splice site probably null
IGL02081:Gcn1l1 APN 5 115585871 missense probably damaging 1.00
IGL02118:Gcn1l1 APN 5 115610879 missense probably damaging 1.00
IGL02150:Gcn1l1 APN 5 115609868 missense probably damaging 1.00
IGL02190:Gcn1l1 APN 5 115614124 missense probably damaging 1.00
IGL02219:Gcn1l1 APN 5 115613767 missense possibly damaging 0.68
IGL02507:Gcn1l1 APN 5 115585881 missense probably benign 0.11
IGL02644:Gcn1l1 APN 5 115575191 missense probably benign
IGL02678:Gcn1l1 APN 5 115613755 missense probably damaging 0.99
IGL02748:Gcn1l1 APN 5 115610800 splice site probably null
IGL02755:Gcn1l1 APN 5 115604006 splice site probably null
IGL02896:Gcn1l1 APN 5 115619648 splice site probably benign
IGL03147:Gcn1l1 UTSW 5 115610858 missense possibly damaging 0.78
R0362:Gcn1l1 UTSW 5 115576108 splice site probably benign
R0540:Gcn1l1 UTSW 5 115588956 missense probably benign 0.00
R0569:Gcn1l1 UTSW 5 115595059 missense probably benign 0.00
R0570:Gcn1l1 UTSW 5 115592421 missense probably damaging 1.00
R0584:Gcn1l1 UTSW 5 115595015 missense probably damaging 1.00
R0630:Gcn1l1 UTSW 5 115581089 missense probably benign 0.06
R0656:Gcn1l1 UTSW 5 115589303 missense probably benign 0.27
R0801:Gcn1l1 UTSW 5 115591006 missense probably benign 0.12
R0890:Gcn1l1 UTSW 5 115579793 missense possibly damaging 0.77
R1400:Gcn1l1 UTSW 5 115614161 missense probably damaging 1.00
R1485:Gcn1l1 UTSW 5 115574617 missense probably benign
R1574:Gcn1l1 UTSW 5 115615552 missense probably benign
R1574:Gcn1l1 UTSW 5 115615552 missense probably benign
R1673:Gcn1l1 UTSW 5 115582297 missense probably benign
R1894:Gcn1l1 UTSW 5 115589115 missense probably damaging 1.00
R2114:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2116:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2117:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2152:Gcn1l1 UTSW 5 115609829 missense probably benign 0.07
R2162:Gcn1l1 UTSW 5 115592132 missense probably benign 0.18
R2216:Gcn1l1 UTSW 5 115593661 missense probably benign
R2218:Gcn1l1 UTSW 5 115619661 missense probably benign 0.04
R2278:Gcn1l1 UTSW 5 115611175 missense probably damaging 1.00
R2280:Gcn1l1 UTSW 5 115612730 missense probably damaging 1.00
R3719:Gcn1l1 UTSW 5 115579817 missense probably benign 0.03
R3833:Gcn1l1 UTSW 5 115592132 missense probably benign 0.18
R3932:Gcn1l1 UTSW 5 115587834 missense probably benign 0.11
R4067:Gcn1l1 UTSW 5 115599088 missense probably damaging 1.00
R4152:Gcn1l1 UTSW 5 115613354 critical splice acceptor site probably null
R4179:Gcn1l1 UTSW 5 115588050 missense probably benign 0.00
R4292:Gcn1l1 UTSW 5 115576148 missense possibly damaging 0.49
R4350:Gcn1l1 UTSW 5 115603330 missense probably damaging 1.00
R4493:Gcn1l1 UTSW 5 115594144 missense probably benign
R4672:Gcn1l1 UTSW 5 115606520 missense probably damaging 1.00
R4749:Gcn1l1 UTSW 5 115614402 missense probably benign
R4753:Gcn1l1 UTSW 5 115616478 missense probably benign
R4826:Gcn1l1 UTSW 5 115593693 missense probably benign
R4873:Gcn1l1 UTSW 5 115576170 missense possibly damaging 0.92
R4875:Gcn1l1 UTSW 5 115576170 missense possibly damaging 0.92
R4932:Gcn1l1 UTSW 5 115592144 missense probably benign 0.00
R4992:Gcn1l1 UTSW 5 115599166 missense probably benign 0.29
R5049:Gcn1l1 UTSW 5 115606671 missense probably damaging 1.00
R5211:Gcn1l1 UTSW 5 115619312 missense probably benign 0.04
R5226:Gcn1l1 UTSW 5 115588067 missense probably benign 0.01
R5338:Gcn1l1 UTSW 5 115583403 missense probably benign 0.00
R5914:Gcn1l1 UTSW 5 115610135 synonymous silent
R5932:Gcn1l1 UTSW 5 115592376 missense possibly damaging 0.77
R6422:Gcn1l1 UTSW 5 115609544 missense probably damaging 1.00
R6435:Gcn1l1 UTSW 5 115611022 critical splice acceptor site probably null
R6607:Gcn1l1 UTSW 5 115609478 missense probably damaging 0.98
R6724:Gcn1l1 UTSW 5 115609158 intron probably null
R6861:Gcn1l1 UTSW 5 115611049 missense probably benign
R6875:Gcn1l1 UTSW 5 115588110 missense probably damaging 1.00
R6910:Gcn1l1 UTSW 5 115606538 missense probably benign 0.42
R6975:Gcn1l1 UTSW 5 115613459 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCTATCAGCCAGCTGGTG -3'
(R):5'- GGGACTATGAAGACAGCCTC -3'

Sequencing Primer
(F):5'- CTGTCCTTGTCCAGGGGAG -3'
(R):5'- GACTATGAAGACAGCCTCACCCC -3'
Posted On2015-03-18