Incidental Mutation 'R7038:Gcn1l1'
ID546845
Institutional Source Beutler Lab
Gene Symbol Gcn1l1
Ensembl Gene ENSMUSG00000041638
Gene NameGCN1 general control of amino-acid synthesis 1-like 1 (yeast)
SynonymsGCN1L, G431004K08Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.938) question?
Stock #R7038 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location115565254-115622654 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 115611144 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1912 (V1912I)
Ref Sequence ENSEMBL: ENSMUSP00000069432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064454]
Predicted Effect probably damaging
Transcript: ENSMUST00000064454
AA Change: V1912I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069432
Gene: ENSMUSG00000041638
AA Change: V1912I

DomainStartEndE-ValueType
low complexity region 64 84 N/A INTRINSIC
low complexity region 108 117 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
Pfam:DUF3554 357 705 2e-61 PFAM
coiled coil region 806 866 N/A INTRINSIC
Blast:ARM 1028 1068 6e-11 BLAST
coiled coil region 1180 1203 N/A INTRINSIC
low complexity region 1457 1466 N/A INTRINSIC
low complexity region 1501 1510 N/A INTRINSIC
ARM 1527 1567 3.69e1 SMART
Blast:ARM 1602 1644 1e-5 BLAST
Blast:EZ_HEAT 1671 1704 1e-7 BLAST
low complexity region 1926 1934 N/A INTRINSIC
low complexity region 1956 1972 N/A INTRINSIC
ARM 2034 2070 9.27e1 SMART
low complexity region 2326 2334 N/A INTRINSIC
ARM 2416 2455 2.16e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (101/102)
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A T 19: 11,110,311 F85L probably benign Het
2010111I01Rik G T 13: 63,190,525 V571F possibly damaging Het
Abl2 T C 1: 156,641,409 S748P possibly damaging Het
Alppl2 T C 1: 87,089,111 D104G probably damaging Het
Als2 C A 1: 59,167,514 W1590L possibly damaging Het
Aplf C T 6: 87,653,823 W210* probably null Het
Ash1l A T 3: 88,982,671 H619L probably benign Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Bpifb1 G T 2: 154,202,669 V19F probably damaging Het
Capn1 A T 19: 6,014,319 L50Q probably benign Het
Carmil1 A G 13: 24,139,335 S245P probably damaging Het
Cavin4 A G 4: 48,672,479 H308R probably benign Het
Cd4 C T 6: 124,870,254 V316M probably damaging Het
Cdcp1 T C 9: 123,173,597 Y803C probably damaging Het
Cep295nl A G 11: 118,332,989 I343T probably benign Het
Cgn T G 3: 94,763,085 T1021P possibly damaging Het
Col6a5 A G 9: 105,945,738 V140A unknown Het
Cops8 T C 1: 90,603,598 probably benign Het
Crhbp A G 13: 95,444,191 Y54H probably damaging Het
Cyp2c29 G A 19: 39,287,127 V4I probably benign Het
Cyp2j6 T A 4: 96,535,471 Y220F probably benign Het
D130043K22Rik A G 13: 24,893,408 D1008G probably damaging Het
Ddx47 T A 6: 135,023,373 V444E possibly damaging Het
Dnttip2 T A 3: 122,276,532 C465* probably null Het
Dst C A 1: 34,182,798 S2561* probably null Het
Dstyk T C 1: 132,454,109 S534P probably benign Het
Eif4e A G 3: 138,527,182 probably benign Het
Eipr1 C T 12: 28,751,818 probably benign Het
Fastkd2 T A 1: 63,731,873 D129E possibly damaging Het
Fndc3b C T 3: 27,501,469 G312D probably benign Het
Gab2 T A 7: 97,303,083 I562N probably damaging Het
Gata5 C A 2: 180,333,892 D160Y possibly damaging Het
Gdf5 C A 2: 155,944,735 Q107H probably damaging Het
Gdpd1 A G 11: 87,035,292 Y276H probably damaging Het
Gins1 A G 2: 150,917,871 Y81C probably damaging Het
Gm28360 T C 1: 117,853,599 C107R probably damaging Het
Hadha T C 5: 30,120,000 probably null Het
Hcn4 A T 9: 58,823,584 I25F unknown Het
Hectd4 A G 5: 121,299,597 Y1095C possibly damaging Het
Hsp90b1 A T 10: 86,695,866 L73Q probably damaging Het
Hspa12a A G 19: 58,804,700 V351A probably damaging Het
Htr1b T A 9: 81,632,243 M104L probably benign Het
Ick C T 9: 78,109,202 probably benign Het
Igf2r T C 17: 12,698,325 T1563A probably benign Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Liph A T 16: 21,976,259 V201E probably damaging Het
Ltn1 T C 16: 87,424,871 D196G probably damaging Het
Med15 C T 16: 17,652,727 D589N possibly damaging Het
Mknk1 A G 4: 115,857,110 D26G probably damaging Het
Mpi T C 9: 57,545,217 D344G probably damaging Het
Mrc2 A G 11: 105,332,236 E435G possibly damaging Het
Mrps5 A G 2: 127,600,866 E285G probably damaging Het
Muc16 T A 9: 18,620,468 M6197L probably damaging Het
Myo3b A T 2: 70,095,208 E34D probably benign Het
Nsd3 T C 8: 25,641,263 S215P probably damaging Het
Nsmce2 T A 15: 59,496,830 probably benign Het
Ntan1 T C 16: 13,826,910 S37P probably benign Het
Nup210l T A 3: 90,159,947 Y765N probably damaging Het
Olfr1193 A T 2: 88,678,741 R288S probably damaging Het
Olfr1495 A T 19: 13,768,351 D3V probably benign Het
Olfr223 T C 11: 59,589,582 Y169C possibly damaging Het
Olfr849 A C 9: 19,441,592 L226F possibly damaging Het
Pald1 T C 10: 61,339,299 H724R probably benign Het
Pcdhb7 A T 18: 37,342,204 D131V possibly damaging Het
Pds5b G T 5: 150,800,760 R1269S probably benign Het
Pikfyve T C 1: 65,234,361 V645A probably damaging Het
Plag1 G T 4: 3,904,676 H172N probably damaging Het
Plch2 G C 4: 154,990,032 probably null Het
Plxnb1 T A 9: 109,100,385 V103E probably damaging Het
Prpf8 T A 11: 75,496,158 M1143K probably benign Het
Ptpn18 T A 1: 34,459,825 M1K probably null Het
Rasgrf2 G A 13: 91,982,833 T703I possibly damaging Het
Rassf6 A T 5: 90,609,725 H125Q probably benign Het
Sdad1 A G 5: 92,298,190 probably null Het
Sf3a3 T A 4: 124,728,426 F426L probably benign Het
Sgsm3 T C 15: 81,008,375 F6L possibly damaging Het
Slc14a2 A T 18: 78,159,037 I626N probably damaging Het
Slc17a8 T C 10: 89,600,221 N165S probably benign Het
Slc41a1 C A 1: 131,842,057 A305D possibly damaging Het
Smyd4 C A 11: 75,390,514 P271Q probably damaging Het
Spag17 C A 3: 99,984,609 H260N probably benign Het
Spata2 A T 2: 167,485,363 V38E possibly damaging Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Syt14 T A 1: 192,983,658 probably benign Het
Tbx21 A G 11: 97,099,771 S329P probably damaging Het
Tex2 A T 11: 106,511,900 probably null Het
Tmem62 A G 2: 120,993,577 I244M possibly damaging Het
Tnks A T 8: 34,851,636 N830K probably damaging Het
Tox2 A G 2: 163,314,344 E145G probably damaging Het
Tpcn1 T C 5: 120,585,277 D7G probably damaging Het
Ttc28 T A 5: 111,266,579 M1320K probably benign Het
Tubgcp5 T G 7: 55,805,366 V270G probably damaging Het
Unc5a A G 13: 55,004,484 R62G probably damaging Het
Unc5d A G 8: 28,715,721 probably null Het
Utrn T C 10: 12,682,338 H1459R probably damaging Het
Vmn2r100 T A 17: 19,505,001 L64Q possibly damaging Het
Wdr55 T G 18: 36,760,420 L45R probably damaging Het
Zfp292 A G 4: 34,816,357 Y306H probably damaging Het
Zfp398 G T 6: 47,866,309 D300Y probably damaging Het
Zfp407 A G 18: 84,561,857 V377A probably damaging Het
Zfp457 G A 13: 67,293,933 H97Y probably benign Het
Zfp467 T C 6: 48,438,138 T527A probably damaging Het
Other mutations in Gcn1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00869:Gcn1l1 APN 5 115588143 splice site probably benign
IGL00974:Gcn1l1 APN 5 115613793 missense possibly damaging 0.88
IGL01566:Gcn1l1 APN 5 115611058 missense probably damaging 1.00
IGL01843:Gcn1l1 APN 5 115619700 missense probably damaging 1.00
IGL01885:Gcn1l1 APN 5 115576115 splice site probably null
IGL02081:Gcn1l1 APN 5 115585871 missense probably damaging 1.00
IGL02118:Gcn1l1 APN 5 115610879 missense probably damaging 1.00
IGL02150:Gcn1l1 APN 5 115609868 missense probably damaging 1.00
IGL02190:Gcn1l1 APN 5 115614124 missense probably damaging 1.00
IGL02219:Gcn1l1 APN 5 115613767 missense possibly damaging 0.68
IGL02507:Gcn1l1 APN 5 115585881 missense probably benign 0.11
IGL02644:Gcn1l1 APN 5 115575191 missense probably benign
IGL02678:Gcn1l1 APN 5 115613755 missense probably damaging 0.99
IGL02748:Gcn1l1 APN 5 115610800 splice site probably null
IGL02755:Gcn1l1 APN 5 115604006 splice site probably null
IGL02896:Gcn1l1 APN 5 115619648 splice site probably benign
IGL03147:Gcn1l1 UTSW 5 115610858 missense possibly damaging 0.78
R0362:Gcn1l1 UTSW 5 115576108 splice site probably benign
R0540:Gcn1l1 UTSW 5 115588956 missense probably benign 0.00
R0569:Gcn1l1 UTSW 5 115595059 missense probably benign 0.00
R0570:Gcn1l1 UTSW 5 115592421 missense probably damaging 1.00
R0584:Gcn1l1 UTSW 5 115595015 missense probably damaging 1.00
R0630:Gcn1l1 UTSW 5 115581089 missense probably benign 0.06
R0656:Gcn1l1 UTSW 5 115589303 missense probably benign 0.27
R0801:Gcn1l1 UTSW 5 115591006 missense probably benign 0.12
R0890:Gcn1l1 UTSW 5 115579793 missense possibly damaging 0.77
R1400:Gcn1l1 UTSW 5 115614161 missense probably damaging 1.00
R1485:Gcn1l1 UTSW 5 115574617 missense probably benign
R1574:Gcn1l1 UTSW 5 115615552 missense probably benign
R1574:Gcn1l1 UTSW 5 115615552 missense probably benign
R1673:Gcn1l1 UTSW 5 115582297 missense probably benign
R1894:Gcn1l1 UTSW 5 115589115 missense probably damaging 1.00
R2114:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2116:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2117:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2152:Gcn1l1 UTSW 5 115609829 missense probably benign 0.07
R2162:Gcn1l1 UTSW 5 115592132 missense probably benign 0.18
R2216:Gcn1l1 UTSW 5 115593661 missense probably benign
R2218:Gcn1l1 UTSW 5 115619661 missense probably benign 0.04
R2278:Gcn1l1 UTSW 5 115611175 missense probably damaging 1.00
R2280:Gcn1l1 UTSW 5 115612730 missense probably damaging 1.00
R3719:Gcn1l1 UTSW 5 115579817 missense probably benign 0.03
R3729:Gcn1l1 UTSW 5 115583394 splice site probably benign
R3833:Gcn1l1 UTSW 5 115592132 missense probably benign 0.18
R3932:Gcn1l1 UTSW 5 115587834 missense probably benign 0.11
R4067:Gcn1l1 UTSW 5 115599088 missense probably damaging 1.00
R4152:Gcn1l1 UTSW 5 115613354 critical splice acceptor site probably null
R4179:Gcn1l1 UTSW 5 115588050 missense probably benign 0.00
R4292:Gcn1l1 UTSW 5 115576148 missense possibly damaging 0.49
R4350:Gcn1l1 UTSW 5 115603330 missense probably damaging 1.00
R4493:Gcn1l1 UTSW 5 115594144 missense probably benign
R4672:Gcn1l1 UTSW 5 115606520 missense probably damaging 1.00
R4749:Gcn1l1 UTSW 5 115614402 missense probably benign
R4753:Gcn1l1 UTSW 5 115616478 missense probably benign
R4826:Gcn1l1 UTSW 5 115593693 missense probably benign
R4873:Gcn1l1 UTSW 5 115576170 missense possibly damaging 0.92
R4875:Gcn1l1 UTSW 5 115576170 missense possibly damaging 0.92
R4932:Gcn1l1 UTSW 5 115592144 missense probably benign 0.00
R4992:Gcn1l1 UTSW 5 115599166 missense probably benign 0.29
R5049:Gcn1l1 UTSW 5 115606671 missense probably damaging 1.00
R5211:Gcn1l1 UTSW 5 115619312 missense probably benign 0.04
R5226:Gcn1l1 UTSW 5 115588067 missense probably benign 0.01
R5338:Gcn1l1 UTSW 5 115583403 missense probably benign 0.00
R5914:Gcn1l1 UTSW 5 115610135 synonymous silent
R5932:Gcn1l1 UTSW 5 115592376 missense possibly damaging 0.77
R6422:Gcn1l1 UTSW 5 115609544 missense probably damaging 1.00
R6435:Gcn1l1 UTSW 5 115611022 critical splice acceptor site probably null
R6607:Gcn1l1 UTSW 5 115609478 missense probably damaging 0.98
R6724:Gcn1l1 UTSW 5 115609158 intron probably null
R6861:Gcn1l1 UTSW 5 115611049 missense probably benign
R6875:Gcn1l1 UTSW 5 115588110 missense probably damaging 1.00
R6910:Gcn1l1 UTSW 5 115606538 missense probably benign 0.42
R6975:Gcn1l1 UTSW 5 115613459 missense probably damaging 1.00
R7027:Gcn1l1 UTSW 5 115616546 critical splice donor site probably null
R7171:Gcn1l1 UTSW 5 115590293 missense probably benign 0.02
R7276:Gcn1l1 UTSW 5 115611060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTAACAAGGTGAGGGCCTG -3'
(R):5'- GTTCCAGTTACATAGGGGACGC -3'

Sequencing Primer
(F):5'- GTGAGGGCCTGCCGATG -3'
(R):5'- TTACATAGGGGACGCCCGTG -3'
Posted On2019-05-13