Incidental Mutation 'R4280:Epha1'
ID322836
Institutional Source Beutler Lab
Gene Symbol Epha1
Ensembl Gene ENSMUSG00000029859
Gene NameEph receptor A1
SynonymsEph, 5730453L17Rik, Esk
MMRRC Submission 041648-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R4280 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location42358487-42373268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 42365052 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 355 (P355T)
Ref Sequence ENSEMBL: ENSMUSP00000073099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073387] [ENSMUST00000164375] [ENSMUST00000204357]
PDB Structure
The solution structure of the second fibronectin type III domain of mouse Ephrin type-A receptor 1 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000073387
AA Change: P355T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073099
Gene: ENSMUSG00000029859
AA Change: P355T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EPH_lbd 28 205 3.23e-103 SMART
FN3 334 430 8.43e-9 SMART
FN3 448 526 1.59e-4 SMART
Pfam:EphA2_TM 549 622 3.4e-13 PFAM
TyrKc 625 881 2.57e-126 SMART
SAM 911 977 4.13e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164375
SMART Domains Protein: ENSMUSP00000126622
Gene: ENSMUSG00000029860

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
low complexity region 61 84 N/A INTRINSIC
low complexity region 92 131 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 174 186 N/A INTRINSIC
low complexity region 199 220 N/A INTRINSIC
low complexity region 250 266 N/A INTRINSIC
low complexity region 269 283 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
low complexity region 343 363 N/A INTRINSIC
LIM 375 428 2.4e-17 SMART
LIM 435 487 7.39e-18 SMART
LIM 495 557 9.31e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204238
Predicted Effect probably damaging
Transcript: ENSMUST00000204357
AA Change: P355T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144763
Gene: ENSMUSG00000029859
AA Change: P355T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EPH_lbd 28 205 1.1e-105 SMART
FN3 334 430 4.2e-11 SMART
low complexity region 459 473 N/A INTRINSIC
FN3 483 563 2.4e-8 SMART
Pfam:EphA2_TM 586 659 7.6e-11 PFAM
STYKc 662 849 1.1e-65 SMART
SAM 879 945 2.5e-21 SMART
Meta Mutation Damage Score 0.214 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene is expressed in some human cancer cell lines and has been implicated in carcinogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most mice homozygous for a null allele exhibit a kinked tail while 18% of mice exhibit vagina atresia with hydrometrocolops and infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T C 17: 47,413,855 M17V probably benign Het
1700021F05Rik A T 10: 43,532,909 F79L probably benign Het
1700057G04Rik T C 9: 92,343,648 Y8H possibly damaging Het
4930415L06Rik A T X: 89,932,499 W31R probably damaging Het
Arhgap32 T C 9: 32,259,889 C1322R probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Arvcf G A 16: 18,397,991 R292H probably damaging Het
Ccdc102a C A 8: 94,907,816 G382* probably null Het
Cd274 A T 19: 29,380,471 M188L probably benign Het
Cep76 T A 18: 67,640,159 D23V probably benign Het
Clec12a A G 6: 129,363,929 Y224C probably damaging Het
Cplx2 A G 13: 54,379,564 E87G probably damaging Het
Ctr9 A G 7: 111,046,723 probably benign Het
Dgat2 A G 7: 99,158,997 I157T probably damaging Het
Fabp3 C T 4: 130,312,452 probably null Het
Gm13078 A G 4: 143,726,022 T8A possibly damaging Het
Gmip T A 8: 69,813,601 probably benign Het
Hephl1 A G 9: 15,112,034 V24A probably benign Het
Itgb4 T A 11: 115,990,935 M771K probably damaging Het
Mov10 A C 3: 104,799,779 F635V probably damaging Het
Olfr1130 A G 2: 87,608,251 T288A possibly damaging Het
Olfr1431 A G 19: 12,209,938 Y124C probably damaging Het
Pbrm1 T C 14: 31,107,312 probably null Het
Plxnd1 C A 6: 115,956,094 probably benign Het
Plxnd1 A T 6: 115,956,095 probably null Het
Pnma5 T C X: 73,035,430 M549V probably benign Het
Polq C A 16: 37,082,057 Q2205K probably damaging Het
Psma8 T A 18: 14,721,235 D57E probably benign Het
Rbm47 T C 5: 66,026,177 Y361C probably damaging Het
Rec8 A G 14: 55,618,634 H11R probably damaging Het
Ric1 A G 19: 29,586,550 Y568C probably damaging Het
Rrp36 G A 17: 46,672,376 T104I probably damaging Het
Rrs1 G A 1: 9,546,139 G206S probably damaging Het
Scgb2b6 A G 7: 31,618,942 noncoding transcript Het
Skint5 T A 4: 113,942,552 K126I probably damaging Het
Slc38a10 C T 11: 120,137,878 G202D probably damaging Het
Supt5 G A 7: 28,317,073 R761W probably damaging Het
Tmtc2 A G 10: 105,348,433 probably null Het
Tob1 T C 11: 94,214,322 V228A probably benign Het
Traj44 T C 14: 54,173,691 probably benign Het
Trps1 G A 15: 50,846,082 L291F probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ush2a A G 1: 188,578,461 Q2078R probably benign Het
Zbtb24 T C 10: 41,464,920 S649P probably benign Het
Zfp28 A T 7: 6,393,701 Q378H probably benign Het
Zfp429 A C 13: 67,390,795 C177G probably damaging Het
Other mutations in Epha1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01591:Epha1 APN 6 42360551 missense probably damaging 1.00
IGL02388:Epha1 APN 6 42365016 missense probably damaging 1.00
IGL02614:Epha1 APN 6 42360557 missense probably benign 0.02
IGL03019:Epha1 APN 6 42362752 missense probably damaging 1.00
buddy UTSW 6 42361451 missense probably damaging 1.00
R0369:Epha1 UTSW 6 42365473 missense probably damaging 1.00
R0894:Epha1 UTSW 6 42363822 missense probably benign 0.45
R1353:Epha1 UTSW 6 42361837 missense probably damaging 0.99
R1451:Epha1 UTSW 6 42361451 missense probably damaging 1.00
R1840:Epha1 UTSW 6 42363588 missense probably damaging 0.99
R2064:Epha1 UTSW 6 42366053 missense probably benign 0.01
R2065:Epha1 UTSW 6 42366053 missense probably benign 0.01
R2067:Epha1 UTSW 6 42366053 missense probably benign 0.01
R2087:Epha1 UTSW 6 42363568 missense probably benign 0.01
R3691:Epha1 UTSW 6 42361130 missense probably damaging 1.00
R3952:Epha1 UTSW 6 42364285 missense probably damaging 0.99
R4111:Epha1 UTSW 6 42358838 missense possibly damaging 0.88
R4369:Epha1 UTSW 6 42365457 missense probably damaging 1.00
R4371:Epha1 UTSW 6 42365457 missense probably damaging 1.00
R4491:Epha1 UTSW 6 42360666 missense probably damaging 1.00
R4743:Epha1 UTSW 6 42372221 missense probably benign 0.00
R4838:Epha1 UTSW 6 42363816 missense probably benign 0.04
R4847:Epha1 UTSW 6 42361914 missense possibly damaging 0.88
R4857:Epha1 UTSW 6 42361482 missense probably benign 0.00
R4884:Epha1 UTSW 6 42360734 missense probably damaging 0.99
R4929:Epha1 UTSW 6 42364599 missense probably benign 0.05
R5239:Epha1 UTSW 6 42365010 missense possibly damaging 0.87
R5416:Epha1 UTSW 6 42365871 missense probably damaging 1.00
R5595:Epha1 UTSW 6 42364634 missense possibly damaging 0.78
R5838:Epha1 UTSW 6 42361646 missense probably damaging 1.00
R6395:Epha1 UTSW 6 42366172 missense probably damaging 1.00
R6594:Epha1 UTSW 6 42364691 missense probably benign
R6639:Epha1 UTSW 6 42365935 nonsense probably null
R7092:Epha1 UTSW 6 42364245 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TCCTGACACTCTGTTTTGGG -3'
(R):5'- TAATCTCTCATGAGGGCTTTGG -3'

Sequencing Primer
(F):5'- CCTGACACTCTGTTTTGGGATTTGAC -3'
(R):5'- CTCTCATGAGGGCTTTGGGAGAC -3'
Posted On2015-06-20